WormBase Tree Display for RNAi: WBRNAi00022680
expand all nodes | collapse all nodes | view schema
WBRNAi00022680 | History_name | JN:yk578d4 | |||
---|---|---|---|---|---|
Homol | Homol_homol | Y59E9AL:RNAi | |||
Sequence_info | DNA_text | gggccaatgagcagcaaagtgacatgcagatagtccaacgggctcatcatatttccgtcgttttgtcgcgttta | yk578d4 | ||
Sequence | yk578d4 | ||||
Experiment | Laboratory | JN | |||
YK | |||||
Date | 17 Jul 2001 00:00:00 | ||||
Genotype | [cgc4769]peIs1 | ||||
Delivered_by | Injection | ||||
Inhibits | Gene | WBGene00021996 | Inferred_automatically | RNAi_primary | |
Transcript | Y59E9AL.6.1 | Inferred_automatically | RNAi_primary | ||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00004769 | ||||
Phenotype_not_observed | WBPhenotype:0000886 | ||||
Remark | co-injectin of gfp dsRNA as a control | ||||
Authors' Web Link-General (http: | |||||
Authors' Web Link-Specific (http: | |||||
Entire sequence of clone used for RNAi not known as only the ends of the sequence were determined. The only target shown is the best match. | |||||
Method | RNAi |