WormBase Tree Display for RNAi: WBRNAi00061037
expand all nodes | collapse all nodes | view schema
WBRNAi00061037 | Homol | Homol_homol | F13D11:RNAi | ||
---|---|---|---|---|---|
Sequence_info | DNA_text | catggattgcgatgtgaagattgacgatgacaacatcactgaaagtcattgctatgaagaaatggaccagggtagtgactcggctgtttcaccaactggcagttcacaaatttcatccggagacgaggagacgaaaaagtgcaaatcgttgtcgttagagcaaataagcgcaagggctaatggaaacaacagcccgatgagcaacgacagtgcaatggagaaagatggcgagagcgctgatgacgcaccacattcaccatcggatacaacatcagttccatctccacctcttcattcgtcttcaatcgtcgcgccaatccctattactccacagccgaatgagtttttgcagtccattcttgcacaagcttccctactcggccccctacttgcaaaccgacctagtgcattttactgtgatcattgcaaaattccatttgatacccagcaagtattggacagtcatatgagattccacacaccagggaacccgttcatgtgcagtgactgtcagtatcaggctttcaatgagc | |||
Experiment | Laboratory | RG | |||
Date | 28 Mar 2003 00:00:00 | ||||
Strain | WBStrain00033326 | ||||
Treatment | concentration of injected RNA was 50 ng/ml | ||||
Delivered_by | Injection | ||||
Inhibits | Predicted_gene | F13D11.2a | Inferred_automatically | RNAi_primary | |
F13D11.2b | Inferred_automatically | RNAi_primary | |||
Gene | WBGene00001824 | Inferred_automatically | RNAi_primary | ||
Transcript | F13D11.2a.1 | Inferred_automatically | RNAi_primary | ||
F13D11.2b.1 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00005908 | ||||
Phenotype | WBPhenotype:0000062 | Remark | includes embryonic and larval lethal | ||
Penetrance | Range | 42 | |||
WBPhenotype:0000439 | Remark | Precocious seam cell differentiation. | |||
WBPhenotype:0000697 | Penetrance | Range | 58 | ||
Method | RNAi |