WormBase Tree Display for RNAi: WBRNAi00061284
expand all nodes | collapse all nodes | view schema
| WBRNAi00061284 | Homol | Homol_homol | M142:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | tgtgcctacaccctccgaaaaggcgcccctgatggcccaatagtccgttttgcaactctcggtgaaagtgtatatcatagatgggaatgcattgaagtggagggtgctgataaggacactttcggaatgttagttcactcttgctatgtggataacggctacggtgatagagtggatattcttgattcgaatggttgtggcctagacgcggtgcttctctcaactccggactacgatacttctctgcgtctcgccacgaaaccctaccacgtatttaagtacgcggaccgcccggtactacaatttcagtgtcaaataacactatgtctgaaatatgatggaggatgtgaagggattactcctcca | |||
| Experiment | Laboratory | NA | |||
| Date | 15 Mar 2005 00:00:00 | ||||
| Genotype | daf-7(e1372) | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | M142.2 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00000853 | Inferred_automatically | RNAi_primary | ||
| Transcript | M142.2.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00025242 | ||||
| Phenotype | WBPhenotype:0000583 | Remark | dauer larvae | ||
| WBPhenotype:0001412 | Remark | In dauer larvae the alae are present although their shape is not completely normal and the circumferential annuli are not interrupted and many run over the lateral cuticle. | |||
| WBPhenotype:0001517 | Remark | In dauer larvae the alae are present although their shape is not completely normal and the circumferential annuli are not interrupted and many run over the lateral cuticle. | |||
| WBPhenotype:0001551 | Remark | In dauer larvae the alae are present although their shape is not completely normal and the circumferential annuli are not interrupted and many run over the lateral cuticle. | |||
| Remark | If grown at 25 degrees celcius, 100% of the larvae carrying daf-7(e1372) will develop into dauer larvae | ||||
| Method | RNAi |
