WormBase Tree Display for RNAi: WBRNAi00061315
expand all nodes | collapse all nodes | view schema
| WBRNAi00061315 | Homol | Homol_homol | T04C10:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | atgtcgatttcgacgattcgccggcaagtgaagaacgtcgcctataatttctcggatgcacaagtaaaggttcgcgaagccacaagcaacgatccatggggaccatccacagcgctcatgtccgaaattgccgacttgacgcacaatccaatggcgttcactgagattatgtcaattgtttggaagcgattaaatgattctggcaaaaactggcgacacgtgtacaaaagtctggtgcttctcgattttctcatcaaatgcggccacgagaaggtcgcgcaacaatgcagagagaacgtgttcaccattgaaacactcaaggatttccagcatgtggaagacaatcgggatcagggcttgaacattcgagagaaagcaaagcagatcacttcactgctctccgacgatgaacgcttgaaaaacgaaagaacacgcttcatcctcacaagaaacaaattcaagcaaaacaatccaggaccggttggagcggaaagtcgtcgcagcaatcgtcatcatgtcaccgacgcgtctcttgaccccgagtacgaagatgctcgtccatctaccgccaccgaggaagagatgcagcttcaaattgctcttgctctttcacgagaggaatgcgaaaaggccgacgagatgcgcaagagcgatgatgctcgccttcaaatggctctggaagagtcgcaaaaggatgccgatcgcctcgcaac | |||
| Experiment | Date | 17 Sep 2004 00:00:00 | |||
| Strain | WBStrain00000001 | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | T04C10.2a | Inferred_automatically | RNAi_primary | |
| T04C10.2b | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00001329 | Inferred_automatically | RNAi_primary | ||
| Transcript | T04C10.2a.1 | Inferred_automatically | RNAi_primary | ||
| T04C10.2b.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00024593 | ||||
| Phenotype_not_observed | WBPhenotype:0000886 | ||||
| Remark | Eggs were placed on RNAi feeding plates, the hatched animals were allowed to grow to one day past the fourth larval stage and then dissected, fixed and stained for analysis of the germline phenotypes. | ||||
| Method | RNAi |
