WormBase Tree Display for RNAi: WBRNAi00063472
expand all nodes | collapse all nodes | view schema
WBRNAi00063472 | Homol | Homol_homol | K01G5:RNAi | ||
---|---|---|---|---|---|
Sequence_info | DNA_text | caaaaatgtcgagcaaatcaacaaagcgagcaaaaatcgaagatccgaaggacaacgtgttcatggtggaaaaagtgctggacaagcgaactggaaaaagccggcagagacgaatttctcatacagtggcaagggattccccgagtctgactctagctgggagccgagagagaatctccagtgcgtcgagatgttggacgagtttgagagggaattttcaaagagagagaaaccaattcgcaaacgacacagccagaagcccgaaccttccgaagatcaagcggatccagaagaggatnaagatgaaaagaaggaaacgaatcaaaatgacaaattctcactggaaggcaagcagttaaaatgcattgtcgggctccccaa | yk470a11.5 | ||
Sequence | yk470a11.5 | ||||
Experiment | Laboratory | PFR | |||
Date | 11 Jan 2002 00:00:00 | ||||
Genotype | lin-53(n833) | ||||
Temperature | 25 | ||||
Delivered_by | Injection | ||||
Inhibits | Predicted_gene | K01G5.2a | Inferred_automatically | RNAi_primary | |
K01G5.2c | Inferred_automatically | RNAi_primary | |||
K01G5.2b | Inferred_automatically | RNAi_primary | |||
Gene | WBGene00001996 | Inferred_automatically | RNAi_primary | ||
Transcript | K01G5.2b.1 | Inferred_automatically | RNAi_primary | ||
K01G5.2a.1 | Inferred_automatically | RNAi_primary | |||
K01G5.2c.1 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00005176 | ||||
Phenotype_not_observed | WBPhenotype:0000886 | ||||
Remark | Entire sequence of clone used for RNAi not known as only the ends of the sequence were determined. The only target shown is the best match. | ||||
Method | RNAi |