WormBase Tree Display for RNAi: WBRNAi00063658
expand all nodes | collapse all nodes | view schema
| WBRNAi00063658 | Homol | Homol_homol | C12C8:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | cgacttgtggaactcctcgtggagctggtgggattccagttaattcaaatgttccaagacgatgattatctcgagtcatagcacgttctccttcgtatacttgaatagagacaccaggctgattgtctgcatacgttgtaaatgttttggaagctttggcaggaattctagtgtttctatcaatcaaattggtcattactcctccagctgtttcaattccatgacttagtgggacaacatcaacgagtaaaacat | |||
| Experiment | Laboratory | AM | |||
| Date | 24 Nov 2003 00:00:00 | ||||
| Genotype | age-1(hx546) | ||||
| Treatment | animals were allowed to grow to adulthood (3 d old) before exposure to RNAi to eliminate the contribution of developmental effects of RNAi on life span | ||||
| Temperature | 25 | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | C12C8.1 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00002026 | Inferred_automatically | RNAi_primary | ||
| Transcript | C12C8.1.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00006377 | ||||
| Phenotype | WBPhenotype:0000039 | Remark | RNAi resulted in a small but reproducible reduction in age-1(hx546) life span. | ||
| Method | RNAi |
