WormBase Tree Display for RNAi: WBRNAi00065676
expand all nodes | collapse all nodes | view schema
WBRNAi00065676 | Homol | Homol_homol | F58B6:RNAi | |||
---|---|---|---|---|---|---|
Sequence_info | DNA_text | aaaacccccaatgtctcacaagcgatacacaatcgacgaggcgagcgaagtgatgaagtcgtttaaccagcaaaaatacgtggatcttcgcgaaagttcggtagaaagtgaccgaatgttggaggaaatgctggaaaagcagaagcaactcgtctggaaatccgttcgaatcgccagaatctcccgggagaaggatcgggccgaaaagactgagacactgatggaagaggttcgattcttctggagcatcgagatgcagtgtaggcatgcggtggaggattggaagcgtcggaagcgagagaatgatcggaagcgtcggacagacaaagtggtgacagagacattggtgcagaagaagagacgcaggaaggttgaggaggaggtggaggaggatcagatggaggatcggaatgaagatcgtgacgaagagttcgatcatggagagggatgtagtggatattaaattatgttaaattgcgattttgcgattttttcggaggaataaatga | yk64a7 | |||
Experiment | Laboratory | SA | ||||
Date | 16 Jun 2006 00:00:00 | |||||
Genotype | pie-1::gfp-rho-1 | |||||
Temperature | 20 | |||||
Delivered_by | Soaking | |||||
Inhibits | Predicted_gene | F58B6.11 | Inferred_automatically | RNAi_primary | ||
Gene | WBGene00306125 | Inferred_automatically | RNAi_primary | |||
Transcript | F58B6.11.1 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | |||||
Interaction | WBInteraction000502581 | |||||
Reference | WBPaper00028408 | |||||
Phenotype_not_observed | WBPhenotype:0000679 | EQ_annotations | Life_stage | WBls:0000006 | PATO:0000460 | |
Remark | Entire sequence of clone used for RNAi not known as only the ends of the sequence were determined. The only target shown is the best match. | |||||
Method | RNAi |