WormBase Tree Display for RNAi: WBRNAi00065828
expand all nodes | collapse all nodes | view schema
| WBRNAi00065828 | Homol | Homol_homol | W02F12:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | atggccgacaagaaggactacgcagctatcgccgaaatcgaaaagcaaattgccgataatgcggcaaatttcgaaaagtggaaaaatgctaacgcgttgcaaagaggatctgccgactataatgcaggagtgacacgattcaccgactgggatcgtgatctacgaacaaggctcgcatctcatcaaggaataaatgtcgaatcaggcccgaaaagcatcgatgcagtccttggagagttgctggataaagtagatggtgctggctttgcacaagcaattcaaattgcaaactccgctgatcctacattttggccaacattacaacaggaatttcacaattttaaagcaaatccaccacagcctgtatatcaaatgcctcgatctcaatattacccaagttttgcctcgagtccatacggttatgcagctccacaagttacatcaaacgttcctgtctatcggcctgttttgccaacaattatcacacttccgaaagcagtctcaccagtccgagacttccaaaagaaaaccggagcgccattccgagatttcagcgtgtaa | |||
| Experiment | Laboratory | BL | |||
| Date | 02 Jan 2007 00:00:00 | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | W02F12.6 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00020951 | Inferred_automatically | RNAi_primary | ||
| Transcript | W02F12.6.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00029092 | ||||
| Phenotype | WBPhenotype:0000062 | Remark | SL21p RNAi in the sut-1 mutant strain produced dramatic reductions in viability and fertility at both 15C and 20C. | ||
| WBPhenotype:0000688 | Remark | SL21p RNAi in the sut-1 mutant strain produced dramatic reductions in viability and fertility at both 15C and 20C. | |||
| Method | RNAi |
