WormBase Tree Display for RNAi: WBRNAi00065966
expand all nodes | collapse all nodes | view schema
| WBRNAi00065966 | Homol | Homol_homol | R144:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | atgcctccaccacctccaccaccgccgcctccacctccgccgccacctccggctgcatcggctccgccaccatccagcaatgctcgaaatgctcttcttggcgatattcataaaggtttaaaactgaaaaagacagtcacgaatgatcgatcagcgccatctgttggaaaagtcgttggaagtagcggatcttcatcgaatggaaattctggaaacggaaatggtccggctgctaaacctccacaaatgtctggcggattaggaggtctttttgcgaatggaatgccaatgaaaccaagcgagaataaaattagacgagcaactactagtataggaccccctccaaccgcctcatcagctccaccagtacctcctcctgctccagttccagctgttgaaggaaaaaagccatcgattgtctcatcatcttcattttctcatcatggtgccacatcttcggctcctcctcctccgcctccaccaccgccagtttcagttccaagctcaaaaccgactccacctccaccgccaccagctcagcagaaaccatcgagtgatcgtgaacagttccgaacgatgagacctctacgaccagcaaatgatgtgaaaccgacaatgtatcgacgaagtggaagttcagaggatataccgcaagcgacgtcggcaaccagactggcacgtccattagctcctccgc | |||
| Experiment | Laboratory | BD | |||
| Date | 03 Dec 2005 00:00:00 | ||||
| Strain | WBStrain00034582 | ||||
| Temperature | 15 | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | R144.4a | Inferred_automatically | RNAi_primary | |
| R144.4b | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00020094 | Inferred_automatically | RNAi_primary | ||
| Transcript | R144.4a.1 | Inferred_automatically | RNAi_primary | ||
| R144.4b.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00027006 | ||||
| Phenotype | WBPhenotype:0000050 | ||||
| WBPhenotype:0000189 | Remark | in wip -1 RNAi-treated embryos, the hypodermal cells distorted to the periphery of the embryo without covering the entire body (disrupted ventral closure) | |||
| WBPhenotype:0000594 | Remark | hypodermal cell migration defective (disrupted ventral closure) | |||
| Phenotype_not_observed | WBPhenotype:0000707 | Remark | organogenesis of the pharynx and intestine occurs in wip-1 RNAi-treated embryos to some extent | ||
| WBPhenotype:0000708 | Remark | organogenesis of the pharynx and intestine occurs in wip-1 RNAi-treated embryos to some extent | |||
| Method | RNAi |
