WormBase Tree Display for RNAi: WBRNAi00066504
expand all nodes | collapse all nodes | view schema
WBRNAi00066504 | Homol | Homol_homol | F52D10:RNAi | ||
---|---|---|---|---|---|
Sequence_info | DNA_text | gagctccgcgacatctgccaagacgttctcaacttgctcgacaagttcctcattccaaaggctggagccgccgagtccaaggtcttctacctcaagatgaagggagactactaccgttacctcgctgaggtcgcctccggagacgacagaaactcggttgtcgagaagtcgcagcaaagctaccaagaggcgttcgacattgccaaggataagatgcaaccaactcacccaatccgcctgggacttgctctcaacttctctgtcttcttctatgagatcttgaacgccccggacaaggcttgccagcttgccaagcaggctttcgatgacgccatcgct | |||
Experiment | Laboratory | LG | |||
Date | 28 Apr 2006 00:00:00 | ||||
Strain | WBStrain00029023 | ||||
Delivered_by | Bacterial_feeding | ||||
Inhibits | Predicted_gene | F52D10.3c | Inferred_automatically | RNAi_primary | |
F52D10.3a | Inferred_automatically | RNAi_primary | |||
Gene | WBGene00001502 | Inferred_automatically | RNAi_primary | ||
Transcript | F52D10.3c.1 | Inferred_automatically | RNAi_primary | ||
F52D10.3a.1 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00027682 | ||||
Phenotype_not_observed | WBPhenotype:0000039 | Remark | Suppresses the life span extension normally observed in this strain (NL3909) which carries extra copies of sir-2.1. | ||
Remark | strain NL3909 overexpresses sir-2.1 | ||||
Method | RNAi |