WormBase Tree Display for RNAi: WBRNAi00069122
expand all nodes | collapse all nodes | view schema
| WBRNAi00069122 | Homol | Homol_homol | T27F2:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | atggcacccgggaccaaaaaaaagtcggatatggcaaaattcacattctacaaagatcgcttgatgacattcaaaaatttcgaatatgatagagacccggatgcaaaatgcacgtctcaagcggttgctcaagccggattttactgcaccggtcctcagtctggcaaatgtgcattttgcaacaaggaacttgattttgacccagaagacgatccgtggtacgagcacacgaaacgtgatgaaccgtgcgagtttgtacggattggaaagctcgatgactcggaattaactattaacgataccgttcgtctctcacaaaccgccatgattatgactaaactctttgagcatgagatgatgataaataatttgtctaatcattcttcttctgatgctctcttcgatcagctgaaaaaagtaccgaacacagcatcgacaacaaaatctaacagccgccgcggcaaataa | |||
| Experiment | Laboratory | MT | |||
| Date | 01 Jun 2000 00:00:00 | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | T27F2.3 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00000249 | Inferred_automatically | RNAi_primary | ||
| Transcript | T27F2.3.1 | Inferred_automatically | RNAi_primary | ||
| T27F2.3.2 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00004303 | ||||
| Phenotype | WBPhenotype:0000436 | Remark | AIR-2 was not localized to chromosomes in the absence of BIR-1 | ||
| Method | RNAi |
