General
People
Want to know more about worm research?
Start here to access information about the species and data available at WormBase [Read more]
Latest updates
Need help?
Get Started
General Search
By Sequence
By Object
By Literature
Data Mining and Batch Queries
For Parasites
For Developers
Top 3 most used tools
Need help?
Get Started
Tools
Commonly requested data
Need help?
External links
We've created different user guides for distinct interests and experience levels [Read more]
Still have questions?
Please use our most recent publication to cite WormBase. Your citation is critical for ensuring the continued development of WormBase! [Read more]
expand all nodes | collapse all nodes | view schema
| WBRNAi00070032 | Homol | Homol_homol | F31A3:RNAi |
|---|---|---|---|
| Sequence_info | DNA_text | atgcgggccattgcattctccatgcgggccatgcgggccaaaaacaattttattgattgggcagacttt | |
| Experiment | Date | 12 Dec 2006 00:00:00 | |
| Strain | WBStrain00000001 | ||
| Delivered_by | Injection | ||
| Species | Caenorhabditis elegans | ||
| Reference | WBPaper00029063 | ||
| Phenotype_not_observed | WBPhenotype:0000886 | ||
| Method | RNAi |
