WormBase Tree Display for RNAi: WBRNAi00076030
expand all nodes | collapse all nodes | view schema
| WBRNAi00076030 | Homol | Homol_homol | M163:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | aggcctaaataatctgccttttccccttctaatatgttcctacctctgtcttctatcatctaacttatcggatctcctcattcccaatccccaatgacacatagaactacgctagtgtcctatgttgtttccaatttcttccctgtaagttctccgtgttcttacaatcttcatgctggtataattatttatctcattcatcaaatttgataatttgacgttcaacgtcttcaataaacattgtaaaattt | |||
| Experiment | Laboratory | EC | |||
| Date | 16 Jan 2001 00:00:00 | ||||
| Strain | WBStrain00000001 | ||||
| Treatment | Injection and feeding protocols used | ||||
| Inhibits | Gene | WBGene00001898 | Inferred_automatically | RNAi_primary | |
| Transcript | M163.3.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00004630 | ||||
| Phenotype | WBPhenotype:0000050 | Penetrance | Low | ||
| WBPhenotype:0000688 | Penetrance | Low | |||
| WBPhenotype:0000812 | Remark | germ nuclei enlarged | |||
| Penetrance | Low | ||||
| WBPhenotype:0000823 | Remark | reduced number of germ nuclei | |||
| Penetrance | Low | ||||
| Method | RNAi |
