WormBase Tree Display for RNAi: WBRNAi00076942
expand all nodes | collapse all nodes | view schema
| WBRNAi00076942 | Homol | Homol_homol | C32E8:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | atactgtaggcacaggtttttgtagctgtaatagtggccattgtgaaggacacgaactcttgtttgaatatatttgtcgagttgatagactgcgttcgcaaattttggatcaagaatattcgaatcgttgcgagcaagcgctgtgacttgaatttctcgactttgcgtcacagctcgtcccggaatataattattgtcggtgagtggccatttctcatgaatcgacattcgttccatcttgctctgagcgccgagtggtgtgaagaggtaaacggcgtcggagagtggattcaggtggagaagtccgactcccattgcggcggtgaagagtagcgggaagacgaaaaatggaagcggatggtcacagatcaggaatccgagctgtcggaacagcgacgccgcacgccgctccacacagtcccatgccat | |||
| Experiment | Laboratory | PK | |||
| Date | 27 Jun 2005 00:00:00 | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | C32E8.8 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00004217 | Inferred_automatically | RNAi_primary | ||
| Transcript | C32E8.8.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00026841 | ||||
| Phenotype | WBPhenotype:0000062 | ||||
| WBPhenotype:0000229 | |||||
| WBPhenotype:0000643 | Remark | tendency to curl and become immobile | |||
| WBPhenotype:0001395 | Remark | fluid filled vacuoles in intestine and hypodermis | |||
| WBPhenotype:0001428 | |||||
| Phenotype_not_observed | WBPhenotype:0000696 | ||||
| Method | RNAi |
