WormBase Tree Display for RNAi: WBRNAi00077187
expand all nodes | collapse all nodes | view schema
| WBRNAi00077187 | Homol | Homol_homol | T19E7:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | atgtacacggacagcaataataggaactttgatgaagtcaaccatcagcatcaacaagaacaagatttcaatggccaatccaaatatgattatccacaattcaaccgtccaatgggtctccgttggcgtgatgatcaacggatgatggagtatttcatgtcgaatggtccagtagaaactgttccagttatgccaatactcaccgagcatccaccagcatctccattcggtagaggaccatctacagaacgtccaaccacatcatctcgatacgagtacagttcgccttctctcgaggatatcgacttgattgatgtgctatggagaagtgatattgctggagagaagggcacacgacaagtggctcctgctgatcagtacgaatgtgatttgcagacgttgacagagaaatcgacagtagcgccactcactgccgaagagaatgctcgatatgaagatctttcgaaaggattctataatggattcttcgagtcgttcaataacaatcaatatcagcagaaacatcagcaacaacaacgagaacaaataaagacaccaactcttgaacatccaactcaaaaagccgaattggaagatgatctgtttgatgaagatcttgctcagcttttcgaggatgtttcaagagaagaaggacaattgaatcaactttttgataataagcaacaacatccagttatcaataatgtttctctgtcggaaggaattgtttataatcaggcaaatttgaccgagatgcaagagatgcgtgattcctgcaatcaagtttccatttcaacaattccaacaacatcgactgctcaaccagagactttgttcaatgtaaccgattcacagactgtcgaacagtggcttccaacagaagttgtaccaaacgatg | |||
| Experiment | Laboratory | LG | |||
| Date | 09 May 2007 00:00:00 | ||||
| Genotype | dod-24::gfp | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | T19E7.2c | Inferred_automatically | RNAi_primary | |
| T19E7.2a | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00004804 | Inferred_automatically | RNAi_primary | ||
| Transcript | T19E7.2a.1 | Inferred_automatically | RNAi_primary | ||
| T19E7.2c.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Interaction | WBInteraction000502918 | ||||
| Reference | WBPaper00030735 | ||||
| Phenotype | WBPhenotype:0001278 | Remark | Authors show skn-1c(RNAi) reduced dod-24-gfp expression in intestine. In a separate experiment they showed that skn-1b(RNAi) did not as skn-1b is expressed primarily in the ASI neuron and skn-1c is expressed primarily in the intestine. | ||
| Remark | In this manuscript authors used RNAi against the different isoforms of skn-1 to shown that skn-1b is expressed primarily in the ASI neuron and skn-1c is expressed primarily in the intestine. This experiments uses RNAi agains the skn-1c isoform. The exact sequence used for skn-1c RNAi not stated by authors, interpreted from figure 2 of their manuscript. | ||||
| Method | RNAi |
