WormBase Tree Display for RNAi: WBRNAi00077725

WBRNAi00077725 Homol: Homol_homol: T24A11:RNAi
  Sequence_info: DNA_text: gatatcggcggtggcggcggtggacgtcgttctgatcgtctcgattcggatcgaaccagtgaagatatgtcatttattgcaagtccagcgaatgaatcgttccagattggcgcttcgtttgttgacgtacagaatgaatcatcaggatcaattgatacggctacagcgacattgcatgaactaaactacacatttggaatgccaccagtaactgaagaatcagaaaatatgccacaaaactatgaaacagtagttgaactgctcccgggtgaagaacgagcgcctatcaacaaattaacagaatttccgattgaaggaggaagtttatttgtcacaaatttcaggatagtagtgatactaaaagataaagaagttgaagaagctcttcgatttcttgtatttccacttcaagacattgaacaaatcgatctcgccatcccagctttcattcatttatctctgaaaattggacgaatgttcacaatttgcttcaaaacggctgaagacgcggctctcgtacacaaaatcctctacacagcatttcaaagactcaatcgtccgatttcatcgatttacacatcgaggccacaggattggacttcgaaaaatacggataatccaatgcaatcgttgaatgcctttgcttggaaattctcggaagcagttgatgagcttgatagagatggaaaacttccttcatggctgctcagagctgattcagtggctcaggagatcactcacattgattttaatcgattgggaatgtcagaacactttcaaatttcaagtgttaatgagaattttgaagtctgcccaacatacccggagaagatcatcgtcccaaaagga
  Experiment: Date: 08 Feb 2008 00:00:00
    Strain: WBStrain00000001
    Temperature: 20
    Delivered_by: Bacterial_feeding
  Inhibits: Predicted_gene: T24A11.1a Inferred_automatically: RNAi_primary
      T24A11.1b Inferred_automatically: RNAi_primary
    Gene: WBGene00003476 Inferred_automatically: RNAi_primary
    Transcript: T24A11.1b.2 Inferred_automatically: RNAi_primary
      T24A11.1a.1 Inferred_automatically: RNAi_primary
      T24A11.1b.1 Inferred_automatically: RNAi_primary
  Species: Caenorhabditis elegans
  Reference: WBPaper00031664
  Phenotype: WBPhenotype:0000007 Penetrance: Low
        Range: 4
    WBPhenotype:0000124 Remark: Phosphatase activity decreased. Diminished phosphatase activity as measured with phosphatidylinositol 3-phosphate (PI3P) as a substrate. Observed a twofold increase in the PI3P contents in the RNAi treated worms.
    WBPhenotype:0000154 Penetrance: Low
        Range: 5 7
    WBPhenotype:0000643 Remark: RNAi-treated worms started to show very sluggish body movement by day 5 (controls at day 9). Their tracks had shorter wavelengths, and their traveling distance at a fixed period of time was much shorter than that exhibited by the control worms. The body movement gradually worsened as the animal aged. By day 8, they became very inactive and failed to move out of a 1 cm diameter cycle within 2 h, and by day 9, their body movement was essentially impaired.
    WBPhenotype:0000646 Remark: RNAi-treated worms started to show very sluggish body movement by day 5 (controls at day 9). Their tracks had shorter wavelengths, and their traveling distance at a fixed period of time was much shorter than that exhibited by the control worms. The body movement gradually worsened as the animal aged. By day 8, they became very inactive and failed to move out of a 1 cm diameter cycle within 2 h, and by day 9, their body movement was essentially impaired.
    WBPhenotype:0001171 Remark: Animals died, on average, on day 14. In contrast, normal worms have an average of lifespan of around 20 days.
  Phenotype_not_observed: WBPhenotype:0000231
    WBPhenotype:0000518
  Method: RNAi