WormBase Tree Display for RNAi: WBRNAi00077795
expand all nodes | collapse all nodes | view schema
| WBRNAi00077795 | Homol | Homol_homol | C30F8:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | gaattcttttctcacgttgcctggagatcatctgtggaagttgcactggaagttgccgcactgaaagtttgcagggattttgcagaacatcagcacaacaaaggcgctgaccatcatctagaagatcttgatatcgaggcttgcattcagtcactcattccaaacgttttgcataatccgggtttcaaacatagtcatctcaaaaagacattcactgcatatatcaaaaagttctcagcgacttcgccaaatgaatcaatcatccgaagcttggcacttttacttgaagtcgttaaatttgatgtggagctattcaaagcaagtcttggagcagggtggacaaaacccgtggagctggttgttggaccacacacaggactttcatacaggcttaatgaacgatgtgatagctcccgactgttggaactccggacgatagcagaaatcacaattagaaaaatggagaatggttccgaaaaaacactgatgcagttgaatctctctggagctgcaaaaccagttcttattactctgtcaactgaagaactttctcaatcattggcacatttgctagatggatatcaaatgttgtataatcaaagggatagtgtgttcaagttaaaaggaattgaaagatgtgaaactttaacaatgcacgaagcaacgattcgaccgaaaa | |||
| Experiment | Laboratory | JE | |||
| Date | 20 Dec 2007 00:00:00 | ||||
| Strain | WBStrain00000001 | ||||
| Treatment | Repeated experiment in kin-32(ok166) background with the same results (Data not shown) | ||||
| Temperature | 23 | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | C30F8.4a | Inferred_automatically | RNAi_primary | |
| C30F8.4b | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00002213 | Inferred_automatically | RNAi_primary | ||
| Transcript | C30F8.4b.2 | Inferred_automatically | RNAi_primary | ||
| C30F8.4a.1 | Inferred_automatically | RNAi_primary | |||
| C30F8.4b.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00031545 | ||||
| Phenotype_not_observed | WBPhenotype:0000039 | ||||
| WBPhenotype:0000062 | |||||
| WBPhenotype:0000145 | |||||
| WBPhenotype:0000195 | |||||
| WBPhenotype:0000520 | |||||
| WBPhenotype:0000603 | Remark | Wild-type organization of muscle dense bodies as assessed by PAT-3/Beta integrin and ATN-1/alpha-actinin staining. | |||
| WBPhenotype:0000643 | |||||
| WBPhenotype:0001273 | Remark | heat shock sensitivity detected | |||
| WBPhenotype:0001587 | Remark | Phalloidin staining used to observe actin filaments. | |||
| Method | RNAi |
