WormBase Tree Display for RNAi: WBRNAi00077990
expand all nodes | collapse all nodes | view schema
| WBRNAi00077990 | Homol | Homol_homol | F53F10:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | catatgcctaccttttcaagtacattatcatcggggatactggagtaggaaaatcctgcttgctccttcagtttaccgacaaacgtttccagccagttcatgatttgacgattggcgtcgaattcggagcccgtatggtgacaattgacggaaagcagatcaaacttcaaatttgggacacagccggacaagaatcattccgctccatcactcgttcctattatcgtggagccgccggagctcttctcgtctacgacattacacgacgcgacacattcaatcatttgacatcttggcttgaggatgccaggcagcacagtaattccaatatggttattatgttgattggaaataagagtgacctggaagcccgtcgcgaagtgaaacgtgaagagggagaagcattcgcacgagagcacggactcgtattcatggagacatctgccaagacggctgccaacgtggaagaggcgttcatcgacactgccaaagagatctaccgtaagattcaagaaggcgtgttcgacattaacaatgaggcaaacggaatcaagttgggaccacagcactctccaagctcaccaaattctccagg | |||
| Experiment | Laboratory | XW | |||
| Date | 18 Jan 2008 00:00:00 | ||||
| Treatment | To determine the engulfment phenotype in germ cells, wild-type animals were transferred to the fresh plates 24 hours post-injection. The F1 progeny were aged and scored at 12, 24, 36, 48 and 60 hours post L4/adult molt. | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | F53F10.4b | Inferred_automatically | RNAi_primary | |
| F53F10.4c | Inferred_automatically | RNAi_primary | |||
| F53F10.4d | Inferred_automatically | RNAi_primary | |||
| F53F10.4a | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00006833 | Inferred_automatically | RNAi_primary | ||
| Transcript | F53F10.4d.1 | Inferred_automatically | RNAi_primary | ||
| F53F10.4b.1 | Inferred_automatically | RNAi_primary | |||
| F53F10.4c.1 | Inferred_automatically | RNAi_primary | |||
| F53F10.4a.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00031498 | ||||
| Phenotype | WBPhenotype:0000885 | ||||
| WBPhenotype:0001180 | |||||
| Method | RNAi |
