WormBase Tree Display for RNAi: WBRNAi00078002
expand all nodes | collapse all nodes | view schema
| WBRNAi00078002 | Homol | Homol_homol | F26D11:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | caacgctgaaacttgagcagtanctccgttcacaagattacctgaaactatatgcgaatgctcatcaatcactattctgtctttaaacgagacaagtctgacactcctaccatctaacattggatctctgacgaatctgcgagttctcgaagctcgagacaatcttctccgaacaattcctctgtcgattgtggaattgagaaaacttgaagagctcgatcttggacaaaatgaacttgaagcactgccggctgaaataggaaaactcacaagtctacgagagttttatgtcgacataaacagtctaacaagccttcctgatagtatctctggctgtagaatgctcgatcaattagatgtatcagaaaaccaaattattcgactacct | |||
| Experiment | Laboratory | SU | |||
| Date | 09 Aug 2001 00:00:00 | ||||
| Genotype | dlg-1 | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | F26D11.11f | Inferred_automatically | RNAi_primary | |
| F26D11.11c | Inferred_automatically | RNAi_primary | |||
| F26D11.11e | Inferred_automatically | RNAi_primary | |||
| F26D11.11d | Inferred_automatically | RNAi_primary | |||
| F26D11.11a | Inferred_automatically | RNAi_primary | |||
| F26D11.11b | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00002632 | Inferred_automatically | RNAi_primary | ||
| Transcript | F26D11.11b.1 | Inferred_automatically | RNAi_primary | ||
| F26D11.11f.1 | Inferred_automatically | RNAi_primary | |||
| F26D11.11e.1 | Inferred_automatically | RNAi_primary | |||
| F26D11.11c.1 | Inferred_automatically | RNAi_primary | |||
| F26D11.11d.1 | Inferred_automatically | RNAi_primary | |||
| F26D11.11a.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Interaction | WBInteraction000050605 | ||||
| Reference | WBPaper00004961 | ||||
| Phenotype | WBPhenotype:0001408 | Remark | LET-413 and DLG-1 cooperatively control AJM-1 localization to apical junctions. Junctional MH27 (AJM-1) staining is completely abolished in dlg-1; let-413(RNAi), whereas with either dlg-1(RNAi) or let-413(RNAi) alone, localization is abberant, but present. | ||
| Method | RNAi |
