WormBase Tree Display for RNAi: WBRNAi00078045
expand all nodes | collapse all nodes | view schema
| WBRNAi00078045 | Homol | Homol_homol | Y49E10:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | atgtcgacgagaaagctcaacaaagtgatggttcagcctgtgaacctcatcttcagatatctccaaaaccgcactcgggtccaaatctggttgtacgaggatgtcacccaccgtctcgagggctacatcatcggattcgacgagttcatgaatgtcgtgttcgacgaagccgaggaggtgaacatgaagacgaagggacgcaacaagatcggcagaattcttctcaaaggagacaacatcactctcatccacgccgcccaacaagaagcctaa | |||
| Experiment | Laboratory | TE | |||
| Date | 04 Jul 2002 00:00:00 | ||||
| Treatment | Followed the effects of SmE RNAi on embryo and germline P granules over time. | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | Y49E10.15 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00004919 | Inferred_automatically | RNAi_primary | ||
| Transcript | Y49E10.15.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00005457 | ||||
| Phenotype | WBPhenotype:0000436 | Remark | PGL-1 (P granule component) not associated with nucleus (perinuclear association) in both embryos and eventually in the gonads (53 percent at 60 hr time point). | ||
| WBPhenotype:0000867 | |||||
| WBPhenotype:0001026 | Remark | Embryos with early nuclear defects (22 percent at 60 hr time point). | |||
| WBPhenotype:0001302 | |||||
| Remark | Exact sequence used for RNAi not stated by authors, spliced coding region sequence of gene used for curation. | ||||
| Method | RNAi |
