WormBase Tree Display for RNAi: WBRNAi00078132
expand all nodes | collapse all nodes | view schema
| WBRNAi00078132 | Homol | Homol_homol | Y41D4B:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | atagcccttgacggagcaacagtgaatgatatttcgtatacttcaaatggtcgagtattctatacagccgacgatcaactcttcgaattcgtctacgagaaacaaaacggatggtttggctccacaaatcacaagtgtcgaggtgtaaatcaaactgcatcaattctcggaacactgatctctctaccattcttcggctcttcaaaagagcccctcgatcagattacaatcgataaatcccgaaatatcatgtatttgctcggccgagccggcaccgtcagtgtctgggatctcggagcggatggagcagcttgtgccaaatttttgagtgttcccatctcgaaaattgcacatgaagctcatattctgacgcaattcggtcacgatgagacatcttttcacagtattacatcgattaaggcgttggaagcttcacaatcggctgcgcttaacctagttgcaactactgccaaaggagttcgattgtacttttcagtgtcgacgggcccgcagtctacgatggctatgtttaataatagtggaacacctaatgaaagagttcgt | |||
| Experiment | Laboratory | BN | |||
| Date | 19 Dec 2008 00:00:00 | ||||
| Temperature | 20 | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | Y41D4B.19a | Inferred_automatically | RNAi_primary | |
| Y41D4B.19b | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00003794 | Inferred_automatically | RNAi_primary | ||
| Transcript | Y41D4B.19b.1 | Inferred_automatically | RNAi_primary | ||
| Y41D4B.19a.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00032497 | ||||
| Phenotype | WBPhenotype:0000436 | Remark | Depletion of NPP-8 by RNAi prevents proper localization of NPP-19. | ||
| WBPhenotype:0001138 | Remark | Depletion of NPP-8 by RNAi prevents proper localization of NPP-19. | |||
| Method | RNAi |
