WormBase Tree Display for RNAi: WBRNAi00078453
expand all nodes | collapse all nodes | view schema
| WBRNAi00078453 | Homol | Homol_homol | C27A2:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | atggaggatctaaacttcgaagaaagaggaagcacccagataccagcctccttgcaacaacacttcagtgcaaagctaggcagacaaaatgaacttgaaaagacaccttctcgtggcggtttggggctggttgtaaactcgtcaaaaactcctggcggaaaatcgcttcagagcttggcatcggcttgtaaagtgccaccttcaaccaagaagaacactattccaattgcttttgaatgttatgaagatgagacagatgatcagattgccgatgtggccaccattaaaaagaccgaaaaacatccatgctctccaatcgacactgcaaaccgatgtgaaacattcgattcgctagctgctgacattgaggacgatatgcttaatttggaagatcaagacgtcgtactttctgaagatcggccatatggagacgttatcgatccggcagagtctgaagcagaagctcttgctgaattgggagtcgaggaatgggactcatatccaccaattgatccagcttcaagaattggcgacgatttcaattatgtgctcagaacagaggatttcgcggaagaaggtgatgtgaaactcgaagaaactcgccatcggactgttattgctgatattgatgaagtgaaaatgagtaaggctgaaagaaatgaactcttttcgatgcttgcggacgatttggatagttacgacctcctcgccgaagaagccaaccttcccctgtga | |||
| Experiment | Laboratory | KR | |||
| Date | 01 Oct 2002 00:00:00 | ||||
| Treatment | Hermaphrodites at stages L3 to L4 were fed bacteria expressing ify-1 dsRNA to get rid of maternal ify-1 component. | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | C27A2.3 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00002068 | Inferred_automatically | RNAi_primary | ||
| Transcript | C27A2.3.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00005604 | ||||
| Phenotype | WBPhenotype:0000040 | Remark | Embryos arrested at one-cell stage. | ||
| WBPhenotype:0000351 | Remark | None of the eggs hatched. | |||
| WBPhenotype:0000372 | Remark | The embryos did not have polar bodies because meiosis I division did not occur. | |||
| WBPhenotype:0000770 | Remark | centrosome formation defects | |||
| WBPhenotype:0000773 | Remark | Embryos contained a large mass of disorganized chromosomes. | |||
| WBPhenotype:0001041 | Remark | The embryos did not have polar bodies because meiosis I division did not occur. | |||
| WBPhenotype:0001078 | Remark | cytokinesis defects | |||
| WBPhenotype:0001378 | Remark | Chromosome segregation during meiosis I and mitosis is defective. | |||
| WBPhenotype:0001499 | Remark | Chromosome segregation during meiosis I and mitosis is defective. | |||
| Remark | Exact sequence used for RNAi not stated by authors, spliced coding region sequence of gene used for curation (C27A2.3.1). | ||||
| Method | RNAi |
