WormBase Tree Display for RNAi: WBRNAi00078901
expand all nodes | collapse all nodes | view schema
| WBRNAi00078901 | Homol | Homol_homol | R05G6:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | aagattcacatcgccatccgttatcatctccgaataagctgaaaagaaaattcctattgcgcggaaagaaaattattcttgaagaagacattgaagaaccagatgaagatgattcaccaactgataaggataagcaccatgtacatccacatccagttgcacctgaattatcagctctcattggtttgccgtcagtaaaattgagccataatatttatcaagacgtcaacaaacatccatttgatggaagtccttcgctctcggaaaataaagtatatacaatgtttgaagctgcagttcccatcttcacttacactgcagaaaggcttgtgaagagttatccaaaaggattacgtcaagattcatcaaatatgcatccaatggtttcttggctttgtggaattcaaagtgttgctatgaacttccaaaccgctggtgaagagcttgatttgaatgcaggattattcagaattaatggaaattgcggttacgttctgaaaccaagttgccttctcgatggagtcgatccaagaagtatggccaaaccaaaattgaagcttggtattggacttttctctgctcagtatcttccaaagtcagaacccggaaaagagatcattgatccatacgtcagtgttcagattttcggaattccacgagatgaaacaaaagcaaaaacaagaatcatcaaggacaatggattcaacccagaatggagggataatttctatttcacactctcgtgcccagagctagcaattattcgattctgtgtaaaagattttgactctacatcttcgaacgactttgttggagaattctcaattcctgttatgagtcttcgtacaggtttctcgcaaattcaactaaataccggatatcaacatactctggacccatctgcat | |||
| Experiment | Laboratory | VP | |||
| Date | 30 May 2004 00:00:00 | ||||
| Treatment | Worms fed bacteria beginning at the L1 larval stage. Authors call this long-term feeding in comparison to experiments they did where feeding began at the late L4 larval stage (short-term feeding). | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | R05G6.8 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00004039 | Inferred_automatically | RNAi_primary | ||
| Transcript | R05G6.8.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00024307 | ||||
| Phenotype_not_observed | WBPhenotype:0000666 | Remark | Basal and ovulatory sheath contractions in these worms were not significantly different from control worms (unpublished data). | ||
| WBPhenotype:0000668 | Remark | normal oocytes | |||
| WBPhenotype:0001200 | Remark | Basal and ovulatory sheath contractions in these worms were not significantly different from control worms (unpublished data). | |||
| Method | RNAi |
