WormBase Tree Display for RNAi: WBRNAi00080219
expand all nodes | collapse all nodes | view schema
| WBRNAi00080219 | Homol | Homol_homol | C09G12:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | tcaaatgtgtcgtcgttggtgacggagccgtcggtaaaacgtgtctcctgatatcctacaccacaaacgcatttcccggagaatatattccgacggtattcgacaactactcagcaaatgtgatggtcgacggtcggccgataaatctcgggctctgggatacagctggacaggaagattacgatcggctccgcgaacgccggctccaaccagtgagccaaacccagggctacgtgatggcaaaggaaatcaaggctgtcaagtatctggagtgctcggcgctcacgcaacgtggtctgaaacaagttttcgatgaggcgat | |||
| Experiment | Laboratory | OD | |||
| Date | 24 Oct 2008 00:00:00 | ||||
| Genotype | cyk-4(or749) | ||||
| Treatment | After injection, worms were allowed to recover for 44-50 hrs at 16C prior to filming | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | C09G12.8b | Inferred_automatically | RNAi_primary | |
| C09G12.8a | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00000424 | Inferred_automatically | RNAi_primary | ||
| Transcript | C09G12.8a.1 | Inferred_automatically | RNAi_primary | ||
| C09G12.8b.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Interaction | WBInteraction000051380 | ||||
| Reference | WBPaper00032405 | ||||
| Phenotype | WBPhenotype:0001129 | Remark | RNAi of ced-10 partially suppresses the cleavage furrow defect of cyk-4(or749) mutants | ||
| Penetrance | Incomplete | ||||
| Range | 30 | ||||
| Method | RNAi |
