WormBase Tree Display for RNAi: WBRNAi00080220
expand all nodes | collapse all nodes | view schema
| WBRNAi00080220 | Homol | Homol_homol | C09G12:RNAi | ||
|---|---|---|---|---|---|
| K03D3:RNAi | |||||
| Sequence_info | DNA_text | aaatgtgtcgtcgttggtgacggagccgtcggtaagacgtgtctcctgctatcgtacactacaaacgcttttcccggagaatatattctaacggtattcgacacctactcaacaaatgtgatggtcgacggaaggccaataaatctcagcctatgggacacagctggacaggacgattacgatcaattccgccacctgtcatttccacaaacagacgtattcctcgtatgctttgcactgaataatccagcaagttttgagaatgttcgtgcaaaatggtatccagaagtatcacatcattgcccaaatacaccgattattttggttggaactaaagctgatttacgcgaggatcgagatactattgaacggctccgtgaacgtcggctccaaccagtgagccacacccagggttacgtgatggcaaaggaaatcaaggcggtcaagtacctggaatgctcggcgcttacccaaattggattgaaacaagttttcgatgaggcaattcgtactgggctcaccccgccacaaacaccacaaacgag | |||
| tcaaatgtgtcgtcgttggtgacggagccgtcggtaaaacgtgtctcctgatatcctacaccacaaacgcatttcccggagaatatattccgacggtattcgacaactactcagcaaatgtgatggtcgacggtcggccgataaatctcgggctctgggatacagctggacaggaagattacgatcggctccgcgaacgccggctccaaccagtgagccaaacccagggctacgtgatggcaaaggaaatcaaggctgtcaagtatctggagtgctcggcgctcacgcaacgtggtctgaaacaagttttcgatgaggcgat | |||||
| Experiment | Laboratory | OD | |||
| Date | 24 Oct 2008 00:00:00 | ||||
| Treatment | After injection, worms were allowed to recover for 44-50 hrs at 16C prior to filming | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | C09G12.8b | Inferred_automatically | RNAi_primary | |
| K03D3.10 | Inferred_automatically | RNAi_primary | |||
| C09G12.8a | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00004287 | Inferred_automatically | RNAi_primary | ||
| WBGene00000424 | Inferred_automatically | RNAi_primary | |||
| Transcript | C09G12.8a.1 | Inferred_automatically | RNAi_primary | ||
| C09G12.8b.1 | Inferred_automatically | RNAi_primary | |||
| K03D3.10.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00032405 | ||||
| Phenotype_not_observed | WBPhenotype:0001129 | Remark | Double RNAi of rac-2 and ced-10 does not affect the cleavage furrow or cytokinesis | ||
| Method | RNAi |
