WormBase Tree Display for RNAi: WBRNAi00080879
expand all nodes | collapse all nodes | view schema
| WBRNAi00080879 | Homol | Homol_homol | F26D11:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | aggtagtcgaataatttggttttctgatacatctgaaatcttttttcaaattttcaaaaattacagttctttgtctataaaatctcacctaattgatcgagcattctacagccagagatactatcaggaaggcttgttagactgtttatgtcgacataaaactctcgtagacttgtgagttttcctatttcagccggcagtgcttcaagttcattttgtccaagatcgagctcttcaagttttctcaattccacaatcgacagaggaattgttcggagaagattgtctcgagcttcgagaactcgcagattcgtcagagatccaatgttagatggtaggagtgtcagacttgtctcgtttaaagacagaatagtgattgatgagcattcgcatatagtttcaggtaatctgaagtcaaaaaatgtttgaaaattattgaataatacaaatacttaccttgtgaacggattactgctcaagttcagcgttg | |||
| Experiment | Laboratory | OLB | |||
| Date | 19 Nov 2008 00:00:00 | ||||
| Genotype | ipp-5(sy605) | ||||
| Treatment | Grew the worms from L1 larvae (P0 generation) on bacteria producing dsRNA. | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | F26D11.11f | Inferred_automatically | RNAi_primary | |
| F26D11.11c | Inferred_automatically | RNAi_primary | |||
| F26D11.11e | Inferred_automatically | RNAi_primary | |||
| F26D11.11d | Inferred_automatically | RNAi_primary | |||
| F26D11.11a | Inferred_automatically | RNAi_primary | |||
| F26D11.11b | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00002632 | Inferred_automatically | RNAi_primary | ||
| Transcript | F26D11.11b.1 | Inferred_automatically | RNAi_primary | ||
| F26D11.11f.1 | Inferred_automatically | RNAi_primary | |||
| F26D11.11e.1 | Inferred_automatically | RNAi_primary | |||
| F26D11.11c.1 | Inferred_automatically | RNAi_primary | |||
| F26D11.11d.1 | Inferred_automatically | RNAi_primary | |||
| F26D11.11a.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Interaction | WBInteraction000051429 | ||||
| Reference | WBPaper00032467 | ||||
| Phenotype | WBPhenotype:0000050 | Remark | ipp-5(sy605) caused partial suppression of lethality. | ||
| WBPhenotype:0000688 | Remark | ipp-5(sy605) caused suppression of sterility from 100 to 36 percent. | |||
| WBPhenotype:0001745 | Remark | ipp-5(sy605) rescues spermathecal and embryonic junctional patterns after depletion of let 413 by RNAi. | |||
| Method | RNAi |
