WormBase Tree Display for RNAi: WBRNAi00081269
expand all nodes | collapse all nodes | view schema
| WBRNAi00081269 | Homol | Homol_homol | F53G12:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | atgggctctcgtgacgatgaatacgactacttgttcaaggttgttctgattggagactcaggcgtcggaaagtcgaatctcctgtctcgtttcacaagaaatgagttcaacttggaatcaaaatcaacaatcggagtcgagtttgccacgagaagcatctcggtagaaggcaagacagtgaaggctcaaatttgggatactgctggacaggaacgttaccgtgccatcacatccgcttactatcgtggggctgtcggagctctcctagtctacgacatcgctaagcatgtgacgtacgagaatgttgagcgatggttgaaggagcttcgtgatcacgccgatcagaacattgtgattatgttggtcggaaacaagagcgacttgcgccatttgcgtgcagttccaacagacgaggccaagatctacgccgaaagaaatcaattgtcgtttattgaaacatctgccctcgacagcaccaacgttgaagcagctttcactaatatcctgacggaaatctacaaatcagtatccaacaagcatgtaggaactgacagacaaggatatggcggtggcagtggtacaatcattccttcgccagcgtccgacccaccaaagaagcagtgttgcatcccataa | |||
| Experiment | Laboratory | MAD | |||
| Date | 08 Jan 2009 00:00:00 | ||||
| Genotype | GFP::DNC-2 | ||||
| Treatment | L4 hermaphrodites were fed on bacteria expressing double-stranded RNA for 3048 h at 25C or 4860 h at 20C before analysis | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | F53G12.1 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00004274 | Inferred_automatically | RNAi_primary | ||
| Transcript | F53G12.1.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00034709 | ||||
| Phenotype_not_observed | WBPhenotype:0000679 | Remark | GFP-DNC-2 properly localized to centrosomes and spindles, similar to that of wild type | ||
| Remark | Exact sequence used for RNAi not stated by authors, spliced coding region sequence of gene used for curation. | ||||
| Method | RNAi |
