WormBase Tree Display for RNAi: WBRNAi00082786
expand all nodes | collapse all nodes | view schema
| WBRNAi00082786 | Homol | Homol_homol | K03D3:RNAi | |||
|---|---|---|---|---|---|---|
| Sequence_info | DNA_text | gctccgtgaacgtcggctccaaccagtgagccacacccagggttacgtgatggcaaaggaaatcaaggcggtcaagtacctggaatgctcggcgcttacccaaattggattgaaacaagttttcgatgaggcaattcgtactgggctcaccccgccacaaacaccacaaacgagagccaaaaagagcaattgcacggtgctttaa | ||||
| Experiment | Laboratory | CX | ||||
| Date | 21 Aug 2001 00:00:00 | |||||
| Genotype | mig-2(lf) | |||||
| Temperature | 20 | |||||
| Delivered_by | Injection | |||||
| Inhibits | Predicted_gene | K03D3.10 | Inferred_automatically | RNAi_primary | ||
| Gene | WBGene00004287 | Inferred_automatically | RNAi_primary | |||
| Transcript | K03D3.10.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | |||||
| Reference | WBPaper00005004 | |||||
| Phenotype | WBPhenotype:0000195 | Remark | Animals exhibited severe defects in distal tip cell migration | |||
| Penetrance | Range | 40 | ||||
| EQ_annotations | Anatomy_term | WBbt:0006865 | PATO:0000460 | |||
| WBPhenotype:0000232 | Remark | Animals exhibited severe defects in CAN cell migration | ||||
| WBPhenotype:0000384 | Remark | Animals exhibited weak to moderate defects in CAN, DD, and VD neuron axon pathfinding | ||||
| Phenotype_not_observed | WBPhenotype:0000885 | Remark | Animals did not exhibit defects in cell corpse phagocytosis | |||
| Method | RNAi |
