WormBase Tree Display for RNAi: WBRNAi00083306
expand all nodes | collapse all nodes | view schema
WBRNAi00083306 | Homol | Homol_homol | C07G1:RNAi | |||
---|---|---|---|---|---|---|
Sequence_info | DNA_text | atatcctcccacgccgacaatgtccatgatgaatggcggagtagataggaaaagagcaaagcgtccaccaaatgttggatctaaagagctcaattcacaagaaaatgagatgcttttcgctttggtcggctcagaagctgtctgtctgactgctgcagttgttcaacttttaaaatcagatcgtggtgcatggagggtcgatttaccacatggagtcatttcacttgttaaagattatgc | ||||
Experiment | Laboratory | YM | ||||
Date | 08 Jan 2003 00:00:00 | |||||
Treatment | L4 larvae were washed with M9 several times and placed on an NGM plate without OP50 for 1 hour. Five worms were selected and immersed in RNA solution for 24 hours and then allowed to recover by incubation at 20C on NGM plates for 36 hours before observation. | |||||
Delivered_by | Soaking | |||||
Inhibits | Predicted_gene | C07G1.4a | Inferred_automatically | RNAi_primary | ||
Gene | WBGene00006957 | Inferred_automatically | RNAi_primary | |||
Transcript | C07G1.4a.1 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | |||||
Reference | WBPaper00005843 | |||||
Phenotype | WBPhenotype:0000050 | Remark | Authors used the yk184g1 clone to target the wsp-1 gene for RNAi knockdown | |||
Penetrance | Range | 15 | ||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | |||
WBPhenotype:0000059 | Penetrance | Range | 20 | |||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | |||
WBPhenotype:0000688 | Penetrance | Range | 20 | |||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | |||
Method | RNAi |