WormBase Tree Display for RNAi: WBRNAi00083372
expand all nodes | collapse all nodes | view schema
WBRNAi00083372 | Homol | Homol_homol | Y62E10A:RNAi | ||
---|---|---|---|---|---|
Sequence_info | DNA_text | atggacaacgatgatggatttgactatttgttcaaaattgtgcttgtcggcgatatgggagtcggaaagacatgtgtagttcaacgcttcagaaatggaacatttgttgatcgtcagggaaccactatcggcgtcgatttcacaatgaaaactcttgtcgttgacggaaagcgtgtaaaattgcaaatctgggatactggaggccaggaacgattccgaacgattactcaatcatattatcgatctgctaatggaattgttttgtgttatgacattacttgcaagcaatcatttggaagtcttcagagatggattgatgatgtttcaaagtttgcagctccgaatgttgtgaagctactcattggtacaaaatgcgatctagaagaccagagagcaatcgaagcagaagaagcggaaatgttgcaaagagctaatggaatgttcgcaatgctcgagactagtgcaaaaggcaatgtgaacgtggacaacgcattcctcgagttagcaacaattctgaagcgacagtatgatcaaggagtcgttgaacaaggctcaagtggtacattccagcttggatccggtggcacgacggctctgggctctccatggcaacgatgttgtcagtacacttga | |||
Experiment | Laboratory | RT | |||
Date | 24 Apr 2006 00:00:00 | ||||
Treatment | L4 larvae were fed bacteria expressing double-stranded RNA for 48 h at 20C. P0 animals were transferred to a new plate and allowed to lay eggs for 12 h. Then, P0 animals were removed from the plate and observed by fluorescence microscopy. F1 progeny were further incubated for 4 d and observed by fluorescence microscopy. | ||||
Temperature | 20 | ||||
Delivered_by | Bacterial_feeding | ||||
Inhibits | Predicted_gene | Y62E10A.9 | Inferred_automatically | RNAi_primary | |
Gene | WBGene00004278 | Inferred_automatically | RNAi_primary | ||
WBGene00044745 | Inferred_automatically | RNAi_primary | |||
Transcript | Y62E10A.20.1 | Inferred_automatically | RNAi_primary | ||
Y62E10A.9.2 | Inferred_automatically | RNAi_primary | |||
Y62E10A.9.1 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00027612 | ||||
Phenotype_not_observed | WBPhenotype:0000679 | Remark | CAV-1-GFP localization not affected | ||
Remark | Exact sequence used for RNAi not stated by authors, spliced coding region sequence of gene used for curation. | ||||
Method | RNAi |