WormBase Tree Display for RNAi: WBRNAi00084025
expand all nodes | collapse all nodes | view schema
| WBRNAi00084025 | Homol | Homol_homol | Y75B8A:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | tggctctggcgtgcaccgactctgcaaattccacattttcacgtgtcgactcaccgacttccggcccatcggaccagctaacaactcatgacttggatcgccacatagaaaagctgatgagatgtgagctcatcgcggagcaagatgtcaaaacactttgcgcaaaagctcgtgaaatcctagcggaagagggcaacgtccaggttatcga | |||
| Experiment | Laboratory | HR | |||
| Date | 15 Dec 2008 00:00:00 | ||||
| Genotype | mel-26(ct61sb4) | ||||
| Treatment | L4 larvae were placed on plates seeded with dsRNA-producing bacteria. Animals were transferred to fresh plates every 24 hr until egg laying ceased. The first broods were not scored for hatching. | ||||
| Temperature | 20 | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | Y75B8A.30 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00004085 | Inferred_automatically | RNAi_primary | ||
| Transcript | Y75B8A.30.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Interaction | WBInteraction000051981 | ||||
| Reference | WBPaper00032438 | ||||
| Phenotype | WBPhenotype:0000351 | Remark | pph-4.1 RNAi partially suppresses the failure to hatch phenotype of the mel-26(ct61sb4) mutation | ||
| Penetrance | Range | 86 | |||
| Method | RNAi |
