WormBase Tree Display for RNAi: WBRNAi00084037
expand all nodes | collapse all nodes | view schema
| WBRNAi00084037 | Homol | Homol_homol | M04C9:RNAi | ||
|---|---|---|---|---|---|
| Y75B8A:RNAi | |||||
| Sequence_info | DNA_text | tggctctggcgtgcaccgactctgcaaattccacattttcacgtgtcgactcaccgacttccggcccatcggaccagctaacaactcatgacttggatcgccacatagaaaagctgatgagatgtgagctcatcgcggagcaagatgtcaaaacactttgcgcaaaagctcgtgaaatcctagcggaagagggcaacgtccaggttatcga | |||
| PCR_product | sjj_M04C9.6 | ||||
| Experiment | Laboratory | HR | |||
| Date | 15 Dec 2008 00:00:00 | ||||
| Genotype | mbk-2(dd5) | ||||
| Treatment | L4 larvae were placed on plates seeded with dsRNA-producing bacteria. Animals were transferred to fresh plates every 24 hr until egg laying ceased. The first broods were not scored for hatching. | ||||
| Temperature | 20 | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | F16A11.3c | Inferred_automatically | RNAi_primary | |
| Y75B8A.30 | Inferred_automatically | RNAi_primary | |||
| F16A11.3d | Inferred_automatically | RNAi_primary | |||
| F16A11.3a | Inferred_automatically | RNAi_primary | |||
| F16A11.3b | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00004085 | Inferred_automatically | RNAi_primary | ||
| WBGene00008878 | Inferred_automatically | RNAi_primary | |||
| Transcript | F16A11.3c.1 | Inferred_automatically | RNAi_primary | ||
| F16A11.3a.1 | Inferred_automatically | RNAi_primary | |||
| Y75B8A.30.1 | Inferred_automatically | RNAi_primary | |||
| F16A11.3b.1 | Inferred_automatically | RNAi_primary | |||
| F16A11.3d.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Interaction | WBInteraction000051986 | ||||
| Reference | WBPaper00032438 | ||||
| Phenotype | WBPhenotype:0000351 | Remark | pph-4.1 and ppfr-1 RNAi mildly enhanced the failure to hatch phenotype of mbk-2(dd5) mutants | ||
| Penetrance | Range | 70 | |||
| Method | RNAi |
