WormBase Tree Display for RNAi: WBRNAi00084886
expand all nodes | collapse all nodes | view schema
| WBRNAi00084886 | Homol | Homol_homol | T10B5:RNAi | |||
|---|---|---|---|---|---|---|
| Sequence_info | DNA_text | atgtctcaaaaatcaaacgacaccacattctcggtcagagccgcgctcttcgcatcacccgtcggctcatcatcagcagttccaaagaagaaagtggctcgagaggtgccacgtgcagggccgccagtttttgccctcgagcacgatgtttcggaagtcaccgacagaaataaagacggcacctttctggctgcagacgcgtgcgctagtggccctactttgaaggttccagacgaaacacaaggttgcccagaaactttcagtgtttcggaacacgaagatgacgacgacgttgagccgatggaagttgatggaaccatcgttccgtcgccccagcgagcaacgccgacacgtggcgtaactccttgcgaaaaatcgacgactccacgcagaagatcctcgagaaagtcgatgccaacgcctgggaagcgtctgttcttcaccagcaaagacactacgaacgaggatcgcaaggctgatgactcgacgcaactggagcttctgatggcaaagattccgcaggagatgtcgggttacatgaaaaagttggccaccgacatcaaagagatgagccaatacgatgcacagctggcgcggaatatcgacgacatggaagcggttttcaaatcccgcgaaactaagctcaagtcagctattgaaatcgccaaggacagcttcatctcgtccgctctgcctcttcgcctcgagaccctggacatgactctgcgtaaagaagaatcgccaaatgatatcgttgcgagacttcacggaagttttctcgac | ||||
| Experiment | Date | 29 Jul 2010 00:00:00 | ||||
| Treatment | L4 hermaphrodites were injected with dsRNA and incubated at 20 C for 48 h before dissection. | |||||
| Temperature | 20 | |||||
| Delivered_by | Injection | |||||
| Inhibits | Predicted_gene | T10B5.6 | Inferred_automatically | RNAi_primary | ||
| Gene | WBGene00020392 | Inferred_automatically | RNAi_primary | |||
| WBGene00020389 | Inferred_automatically | RNAi_primary | ||||
| Transcript | T10B5.3a.2 | Inferred_automatically | RNAi_primary | |||
| T10B5.6.1 | Inferred_automatically | RNAi_primary | ||||
| Species | Caenorhabditis elegans | |||||
| Reference | WBPaper00037073 | |||||
| Phenotype | WBPhenotype:0000436 | Remark | KNL-1 is not detected at the cup-like kinetochore following KNL-3 depletion. | |||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | |||
| Method | RNAi |
