WormBase Tree Display for RNAi: WBRNAi00085020
expand all nodes | collapse all nodes | view schema
| WBRNAi00085020 | Homol | Homol_homol | Y105E8B:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | gaattggtgcacgagaaggaacgctacaagaccatctccgaagaactcgattccaccttccaagagctctccggatattaaacatccatgtcctatcgcgttccttttttccccccgcctacttgtattttcgtcacaacatcttatcccccccacccaaaaacctttgaaaccatcaaaaccactcaaactttcctattttctttacttttttaaatacttttttataaaagcttcacattatcaactgtttttctctgtgtattcatccccacccctcccatccaaaaaccaagaattctcttttagcagatgagaagcttcaattgttcttttttctttctctctcatgcaaatgttcttcgtttacaagagccggcagc | |||
| Experiment | Laboratory | ON | |||
| Date | 24 Mar 2004 00:00:00 | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | Y105E8B.1n | Inferred_automatically | RNAi_primary | |
| Y105E8B.1r | Inferred_automatically | RNAi_primary | |||
| Y105E8B.1q | Inferred_automatically | RNAi_primary | |||
| Y105E8B.1m | Inferred_automatically | RNAi_primary | |||
| Y105E8B.1p | Inferred_automatically | RNAi_primary | |||
| Y105E8B.1a | Inferred_automatically | RNAi_primary | |||
| Y105E8B.1k | Inferred_automatically | RNAi_primary | |||
| Y105E8B.1o | Inferred_automatically | RNAi_primary | |||
| Y105E8B.1s | Inferred_automatically | RNAi_primary | |||
| Y105E8B.1l | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00002978 | Inferred_automatically | RNAi_primary | ||
| Transcript (16) | |||||
| Species | Caenorhabditis elegans | ||||
| Interaction | WBInteraction000500378 | ||||
| Reference | WBPaper00013408 | ||||
| Phenotype | WBPhenotype:0000666 | Remark | Ovulation at much higher rates when unc-60(r398) is in this background. | ||
| WBPhenotype:0000668 | Remark | unc-60(r398) partially suppressed the Emo phenotype conferred by CeTM (RNAi). | |||
| WBPhenotype:0000688 | Remark | unc-60(r398) partially suppressed the sterile phenotype conferred by CeTM (RNAi). | |||
| Phenotype_not_observed | WBPhenotype:0000979 | Remark | unc-60(r398) suppressed the spermatheca dilation defective phenotype conferred by CeTM (RNAi). | ||
| Method | RNAi |
