WormBase Tree Display for RNAi: WBRNAi00085329
expand all nodes | collapse all nodes | view schema
WBRNAi00085329 | Homol | Homol_homol | T08B2:RNAi | ||
---|---|---|---|---|---|
Sequence_info | DNA_text | tggaaggttgaatccctgaaatgacgaggattttattttaaatattttccgtccggtaacgcctcgacataccgaactgaaacactcgaacgagcgttttggatagggaaagcctgaaaaccggcaaagcagctttcaggactcccataactgaatcttaattttttgaaaacttacagcggccttgagcatgtcgctggtatcagtgtcaaccttgatggaggtgagttgagatggatcaacagtggagatctctggcatgtagttgtctctgcgctcacgctcctcttcttgaagcttgatggagatacctctgactggtcctctctcgatacgtctcatcaagtgagtgatgtatctggaatggagaaattgaatgaaaaaaaattatgaattgtgagttacccagcgatcttgtttctgagtggcttgcttccgatgatggcaacctcgtcacagacgcgcttgttgttatggaagtcattggtcatgcgagtgtagtacttctcgatgaggacacgggaagccttcttgacggtcttggtacgaaca | |||
Experiment | Laboratory | OD | |||
Date | 24 Mar 2011 00:00:00 | ||||
Strain | WBStrain00029219 | ||||
Treatment | Larval L4 stage worms were soaked in dsRNA for 24 hrs at 20C. After soaking, the worms were transferred to NGM plates seeded with OP50 E. coli and allowed to recover for 48 hrs prior to imaging. | ||||
Temperature | 20 | ||||
Delivered_by | Soaking | ||||
Inhibits | Predicted_gene | T08B2.10 | Inferred_automatically | RNAi_primary | |
Gene | WBGene00004486 | Inferred_automatically | RNAi_primary | ||
Transcript | T08B2.10.1 | Inferred_automatically | RNAi_primary | ||
DB_info | Database | Phenobank2 | Gene&RNAID | GeneID=512976 | |
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00038381 | ||||
Phenotype (15) | |||||
Remark | Experiment SS011 | ||||
Method | RNAi |