WormBase Tree Display for RNAi: WBRNAi00085781
expand all nodes | collapse all nodes | view schema
| WBRNAi00085781 | Homol | Homol_homol | F27C1:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | attccattcaagacccaacggttgttttagcacagcctcatagtcttcaactcgggagtaggggaatggtagagaacgtggctggatctttccgataccctgaaagctcatttttgcaattaaaaaatctaggagatatatcaggtgcttacatccttagccgtcatattttcagcaataattactccgtttctctctccgtcccttcttctcttctcttttgctttaatcacaaagttttggcgtcgcttcttctcagtcattcctggtccaacccatgagccccatccggccaaattgagatctacatctttaactttttccttttctttcactccttctttcatatcttcaaaatctccaatgacgtcatcatccttgaaagcttcattgataacttgagcggcttctgcaggaaaaaatcgttggaatatagttaataaaaagaaaaaaaaagattaagcttaccttcatcaaactgatccattttctcaacaaaatccgacgaaacttgtgtcaagtcgtttgtgttgagctctagaaatttgctcggatcgatttcaatttccttttgtcgtttttcagcggcatgcactccagctgaatccactgccttttccactttttcatcaaaagtttctgcacgtttagcctccatcttcggatcataattcttatcaacatatgatacttttccaattgttccttttctcgctgactccttcgcttttagtagcttctttttcttctgctttgcctttttcgcatcttctttctcttgccaagtgtcatcgacgtcgaatagaggattttcacgtgatgcaccagtattcgctgaaatacttcgagttatagcagcttcttgtcgtttcttggctcgcatctgagcaagtgtcactttttgagcatcggagtcttcgaggaaagtatcaactagagccgtgccaacttg | |||
| Experiment | Laboratory | OD | |||
| Date | 24 Mar 2011 00:00:00 | ||||
| Strain | WBStrain00029219 | ||||
| Treatment | Larval L4 stage worms were soaked in dsRNA for 24 hrs at 20C. After soaking, the worms were transferred to NGM plates seeded with OP50 E. coli and allowed to recover for 48 hrs prior to imaging. | ||||
| Temperature | 20 | ||||
| Delivered_by | Soaking | ||||
| Inhibits | Predicted_gene | F27C1.6 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00017855 | Inferred_automatically | RNAi_primary | ||
| Transcript | F27C1.6.2 | Inferred_automatically | RNAi_primary | ||
| F27C1.6.1 | Inferred_automatically | RNAi_primary | |||
| DB_info | Database | Phenobank2 | Gene&RNAID | GeneID=507468 | |
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00038381 | ||||
| Phenotype | WBPhenotype:0000688 | ||||
| WBPhenotype:0001940 | Remark | Convoluted rachis. | |||
| Rachis constriction in proximal region delayed. | |||||
| WBPhenotype:0001941 | |||||
| WBPhenotype:0001944 | |||||
| WBPhenotype:0001950 | Remark | Shortened diplotene region. | |||
| WBPhenotype:0001952 | Remark | Nuclei irregularly positioned in germline compartments. | |||
| WBPhenotype:0001969 | Remark | Rounded compartments distal to turn in gonad. | |||
| WBPhenotype:0001972 | |||||
| Remark | Experiment SS470 | ||||
| Method | RNAi |
