WormBase Tree Display for RNAi: WBRNAi00086598
expand all nodes | collapse all nodes | view schema
WBRNAi00086598 | Homol | Homol_homol | C32D5:RNAi | |||
---|---|---|---|---|---|---|
Sequence_info | DNA_text | gggcttacaaggaggagaacaactttgagaagcgtcgtgccgaaggagacaagatccgcagaaagtacccagaccgtattccagtgattgttgagaaagcaccaaagtcaaagctccatgacttggataagaagaagtacttggtcccatccgatcttactgttggacagttctacttcctcatcagaaaacgcatccaacttcgtccagaagatgctctgttcttctttgtcaacaatgtcattccacaaaccatgaccacaatgggacaactctaccaggaccatcacgaggaagacttgttcctttacatcgcctacagtgacgaaagtgtgtatggaggagaggtcgaaaagaagg | ||||
Experiment | Laboratory | TTV | ||||
Date | 10 Jan 2007 00:00:00 | |||||
Genotype | mec-4(u231) | |||||
Temperature | 20 | |||||
Delivered_by | Bacterial_feeding | |||||
Inhibits | Predicted_gene | C32D5.9 | Inferred_automatically | RNAi_primary | ||
Gene | WBGene00002980 | Inferred_automatically | RNAi_primary | |||
Transcript | C32D5.9.1 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | |||||
Interaction | WBInteraction000500884 | |||||
Reference | WBPaper00029139 | |||||
Phenotype | WBPhenotype:0000179 | Remark | RNAi of lgg-1 partially suppresses the touch receptor neuron vacuolization and death caused by the mec-4(u231) mutation | |||
EQ_annotations | Life_stage | WBls:0000024 | PATO:0000460 | |||
Method | RNAi |