WormBase Tree Display for RNAi: WBRNAi00087295
expand all nodes | collapse all nodes | view schema
| WBRNAi00087295 | Homol | Homol_homol | VZK822L:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | acggcggcccagagacgcaatatctcgccgtggatccaaatgaaattattcaacttcaagaggagagcaagaagatcccatataaaatggaaattgtgtggcgtaacgtggctctctttgctgctcttcacttcgctgcagccatcggactctaccagctcatcttcgaggcaaaatggcaaaccgtgattttcacattccttctgtatgtgttcggaggatttggaataaccgccggagctcatcgtctctggtcccacaaatcatacaaagcaacaactccaatgagaatcttcttgatgatcttgaacaatattgctcttcaaaatgacgtcatcgaatgggctcgtgatcatcgttgccatcacaagtggactg | |||
| Experiment | Date | 02 Apr 2008 00:00:00 | |||
| Temperature | 20 | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | VZK822L.1b | Inferred_automatically | RNAi_primary | |
| VZK822L.1a | Inferred_automatically | RNAi_primary | |||
| VZK822L.1c | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00001398 | Inferred_automatically | RNAi_primary | ||
| Transcript | VZK822L.1b.1 | Inferred_automatically | RNAi_primary | ||
| VZK822L.1a.1 | Inferred_automatically | RNAi_primary | |||
| VZK822L.1c.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Interaction | WBInteraction000503599 | ||||
| WBInteraction000517801 | |||||
| Reference | WBPaper00031804 | ||||
| Phenotype | WBPhenotype:0000136 | Remark | mRNA levels of sod-3, acs-2, and ech-1 increased substantially upon fat-6(RNAi), as determined by RT-PCR | ||
| WBPhenotype:0000137 | Remark | mRNA levels of fasn-1 were reduced upon fat-6(RNAi), as determined by RT-PCR | |||
| WBPhenotype:0000640 | Remark | Authors recorded an average ovipositional delay of several hours | |||
| WBPhenotype:0001905 | Remark | Animals exhibited a modest reduction in the number of eggs laid compared to control | |||
| Phenotype_not_observed | WBPhenotype:0000351 | Remark | Animals exhibited wild type hatching rates | ||
| Method | RNAi |
