WormBase Tree Display for RNAi: WBRNAi00087306
expand all nodes | collapse all nodes | view schema
| WBRNAi00087306 | Homol | Homol_homol | K10C3:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | ttgcggaaccatgtgccgtttgtggtgacaaatcaactggaacccattatggagtcatttcctgcaacgggtgtaagggattcttccgccgaacagttcttcgtgatcagaagttcacttgccgtttcaacaaaagatgtgtgattgacaaaaactttcgatgcgcgtgtcgttattgtcgctttcaaaagtgtgtacaagttggaatgaaacgagaagctattcaattcgaacgtgatcctgtaggttcaccaacatctggagccagtctcaacgggactccattcaaaaaagacagaagccccggatacgagaacggaaacagcaacggtgtcggatcaaacggtatgggacaagagaatatgcg | |||
| Experiment | Date | 02 Apr 2008 00:00:00 | |||
| Genotype | Psod-3::GFP; lin-15(n765) | ||||
| Treatment | Psod-3::gfp worms were bred on RNAi plates for 72 h, and observed under fluorescence microscope (DMRXA, Leica) after fixation by paraformaldehyde | ||||
| Temperature | 20 | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | K10C3.6a | Inferred_automatically | RNAi_primary | |
| K10C3.6c | Inferred_automatically | RNAi_primary | |||
| K10C3.6b | Inferred_automatically | RNAi_primary | |||
| K10C3.6d | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00003639 | Inferred_automatically | RNAi_primary | ||
| Transcript | K10C3.6a.1 | Inferred_automatically | RNAi_primary | ||
| K10C3.6d.1 | Inferred_automatically | RNAi_primary | |||
| K10C3.6a.2 | Inferred_automatically | RNAi_primary | |||
| K10C3.6c.1 | Inferred_automatically | RNAi_primary | |||
| K10C3.6b.1 | Inferred_automatically | RNAi_primary | |||
| K10C3.6b.2 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Interaction | WBInteraction000517806 | ||||
| Reference | WBPaper00031804 | ||||
| Phenotype_not_observed | WBPhenotype:0000962 | Remark | Expression of the sod-3::GFP transgene was not substantially changed upon nhr-49(RNAi) | ||
| Method | RNAi |
