Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for RNAi: WBRNAi00088833

expand all nodes | collapse all nodes | view schema

Name Class

WBRNAi00088833HomolHomol_homolF53G12:RNAi
Sequence_infoDNA_textatgggctctcgtgacgatgaatacgactacttgttcaaggttgttctgattggagactcaggcgtcggaaagtcgaatctcctgtctcgtttcacaagaaatgagttcaacttggaatcaaaatcaacaatcggagtcgagtttgccacgagaagcatctcggtagaaggcaagacagtgaaggctcaaatttgggatactgctggacaggaacgttaccgtgccatcacatccgcttactatcgtggggctgtcggagctctcctagtctacgacatcgctaagcatgtgacgtacgagaatgttgagcgatggttgaaggagcttcgtgatcacgccgatcagaacattgtgattatgttggtcggaaacaagagcgacttgcgccatttgcgtgcagttccaacagacgaggccaagatctacgccgaaagaaatcaattgtcgtttattgaaacatctgccctcgacagcaccaacgttgaagcagctttcactaatatcctgacggaaatctacaaatcagtatccaacaagcatgtaggaactgacagacaaggatatggcggtggcagtggtacaatcattccttcgccagcgtccgacccaccaaagaagcagtgttgcatcccataa
ExperimentLaboratoryMAD
Date14 Mar 2011 00:00:00
Genotype[GFP::TBB-2; GFP::PAR-2; mCherry::PAR-6]
TreatmentL4-stage hermaphrodites were fed bacteria expressing double-stranded RNA. Complete depletion of RAB-11 results in decreased brood size and sterility due to defects in embryogenesis and germline membrane organization. Therefore, a 1:1 ratio of bacterial cultures containing rab-11(RNAi) plasmid and L4440 vector were mixed together to reduce the RNAi effect. RNAi experiments were performed for 20-25 hours at 20 degrees C
Delivered_byBacterial_feeding
InhibitsPredicted_geneF53G12.1Inferred_automaticallyRNAi_primary
GeneWBGene00004274Inferred_automaticallyRNAi_primary
TranscriptF53G12.1.1Inferred_automaticallyRNAi_primary
SpeciesCaenorhabditis elegans
ReferenceWBPaper00038375
PhenotypeWBPhenotype:0000034Remarkrab-11(RNAi) embryos displayed rotated boundaries between PAR-6- and PAR-2- occupied domains during the polarity maintenance phase of the first cell cycle (Fig. 4H and 5D). RAB-11 knockdown also affected establishment phase. Polarity failed to completely establish in rab-11(RNAi) embryos (Fig. 4G).
WBPhenotype:0000679Remarkrab-11(RNAi) embryos displayed rotated boundaries between PAR-6- and PAR-2- occupied domains during the polarity maintenance phase of the first cell cycle (Fig. 4H and 5D). RAB-11 knockdown also affected establishment phase. Polarity failed to completely establish in rab-11(RNAi) embryos (Fig. 4G).
WBPhenotype:0001588Remarkrab-11(RNAi) led to shorter astral microtubules at the nuclear envelope breakdown of the first cell cycle.
Remarkrab-11(RNAi)
MethodRNAi