WormBase Tree Display for RNAi: WBRNAi00088833
expand all nodes | collapse all nodes | view schema
WBRNAi00088833 | Homol | Homol_homol | F53G12:RNAi | ||
---|---|---|---|---|---|
Sequence_info | DNA_text | atgggctctcgtgacgatgaatacgactacttgttcaaggttgttctgattggagactcaggcgtcggaaagtcgaatctcctgtctcgtttcacaagaaatgagttcaacttggaatcaaaatcaacaatcggagtcgagtttgccacgagaagcatctcggtagaaggcaagacagtgaaggctcaaatttgggatactgctggacaggaacgttaccgtgccatcacatccgcttactatcgtggggctgtcggagctctcctagtctacgacatcgctaagcatgtgacgtacgagaatgttgagcgatggttgaaggagcttcgtgatcacgccgatcagaacattgtgattatgttggtcggaaacaagagcgacttgcgccatttgcgtgcagttccaacagacgaggccaagatctacgccgaaagaaatcaattgtcgtttattgaaacatctgccctcgacagcaccaacgttgaagcagctttcactaatatcctgacggaaatctacaaatcagtatccaacaagcatgtaggaactgacagacaaggatatggcggtggcagtggtacaatcattccttcgccagcgtccgacccaccaaagaagcagtgttgcatcccataa | |||
Experiment | Laboratory | MAD | |||
Date | 14 Mar 2011 00:00:00 | ||||
Genotype | [GFP::TBB-2; GFP::PAR-2; mCherry::PAR-6] | ||||
Treatment | L4-stage hermaphrodites were fed bacteria expressing double-stranded RNA. Complete depletion of RAB-11 results in decreased brood size and sterility due to defects in embryogenesis and germline membrane organization. Therefore, a 1:1 ratio of bacterial cultures containing rab-11(RNAi) plasmid and L4440 vector were mixed together to reduce the RNAi effect. RNAi experiments were performed for 20-25 hours at 20 degrees C | ||||
Delivered_by | Bacterial_feeding | ||||
Inhibits | Predicted_gene | F53G12.1 | Inferred_automatically | RNAi_primary | |
Gene | WBGene00004274 | Inferred_automatically | RNAi_primary | ||
Transcript | F53G12.1.1 | Inferred_automatically | RNAi_primary | ||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00038375 | ||||
Phenotype | WBPhenotype:0000034 | Remark | rab-11(RNAi) embryos displayed rotated boundaries between PAR-6- and PAR-2- occupied domains during the polarity maintenance phase of the first cell cycle (Fig. 4H and 5D). RAB-11 knockdown also affected establishment phase. Polarity failed to completely establish in rab-11(RNAi) embryos (Fig. 4G). | ||
WBPhenotype:0000679 | Remark | rab-11(RNAi) embryos displayed rotated boundaries between PAR-6- and PAR-2- occupied domains during the polarity maintenance phase of the first cell cycle (Fig. 4H and 5D). RAB-11 knockdown also affected establishment phase. Polarity failed to completely establish in rab-11(RNAi) embryos (Fig. 4G). | |||
WBPhenotype:0001588 | Remark | rab-11(RNAi) led to shorter astral microtubules at the nuclear envelope breakdown of the first cell cycle. | |||
Remark | rab-11(RNAi) | ||||
Method | RNAi |