WormBase Tree Display for RNAi: WBRNAi00090804
expand all nodes | collapse all nodes | view schema
WBRNAi00090804 | Homol | Homol_homol | R11A5:RNAi | ||
---|---|---|---|---|---|
Sequence_info | DNA_text | gttaagcccgtgtcgttgtaagatgactggaattgttgttagacgagttgttgctcacgcgaatcgtcgataaaattgaatcgagccgctcgacttttgtcatcaggtctttgacgattcgattgatgcaagcaccggcgcccgtaccggtagatactcgttggctctgaaagctatgtaaatgttggctgagaactataaatgggttagcaaatattgttttttcggtctattctgcatctagagatgctatcgtttatagttgtgagggaaaaaagaattagaactcgctgcaagagtttttcgactaaatgtttttcattccgaaataaggtgtgaagctattaattgatcgaaatttgcaggtcttctttgaattaatatttggatatttactttcaaaaatccaccaaaaaaagaaaatttacgtactttttcttgaatatttttattgtcatcgatgcgcacttcgtcaatttttgcaatagtttcctccattcgaacatcttcgtggtgctgcacgtcttccatgaaaacatcttccgagccttaaatagtactagttattttcattctcaaaatgcgacaaatacttactcattttaaactcttctttacttggacctggggatggctcgtccggcagaatttctggatcattcctcaatggttctacaatcaaacgtggccgttctgttgttcgaagttgttcttctcgtaatctatgcatttcttcagcagcaacttgccgttcataaagctcactttccaacattgctatcttttcaatagcatgatccagtttcgatccgagatcagatgctagatattccttatttctttctgatgtttcgagcacatcgtttctctgttccagttttcgaattctttctctctgactttcacattgttcatgaagatgtgagttttctcgtcttaattgctcttcgacttgtgcaaattgtacacgggaatcgtcctgtcgatc | |||
Experiment | Laboratory | MZE | |||
Date | 19 Apr 2012 00:00:00 | ||||
Genotype | unc-119(ed3) III; cbgIs91[pPept-1:pept-1::DsRed;unc-119(+)]; cbgIs98[pPept-1:GFP::rab-11.1;unc-119(+)] | ||||
Treatment | Animals were fed dsRNA-expressing bacteria from the L1 stage of the P0 generation; F1 young adult animals were imaged and scored for phenotypes | ||||
Delivered_by | Bacterial_feeding | ||||
Inhibits | Predicted_gene | R11A5.2 | Inferred_automatically | RNAi_primary | |
Gene | WBGene00011230 | Inferred_automatically | RNAi_primary | ||
Transcript | R11A5.2.1 | Inferred_automatically | RNAi_primary | ||
Species | Caenorhabditis elegans | ||||
Interaction | WBInteraction000519813 | ||||
Reference | WBPaper00041129 | ||||
Phenotype | WBPhenotype:0000679 | Remark | PEPT-1::DsRED accumulated in fuzzy or irregularly shaped structures; PEPT-1::DsRED fluorescence intensity reduced; PEPT-1::DsRed can be retained in misplaced RAB-11-recycling endosomes (REs); GFP::RAB-11 recycling endosomes (REs) localise basally; GFP::RAB-11 recycling endosomes (REs) distribute evenly or scatter throughout the cell; GFP::RAB-11 recycling endosomes (REs) accumulate within the cell; accumulations can be of different size, abundance, and sub-cellular localisation; Autofluorescent lysosome-related organelles (AF/LROs) are enlarged or accumulated | ||
WBPhenotype:0001278 | Remark | PEPT-1::DsRED accumulated in fuzzy or irregularly shaped structures; PEPT-1::DsRED fluorescence intensity reduced; PEPT-1::DsRed can be retained in misplaced RAB-11-recycling endosomes (REs); GFP::RAB-11 recycling endosomes (REs) localise basally; GFP::RAB-11 recycling endosomes (REs) distribute evenly or scatter throughout the cell; GFP::RAB-11 recycling endosomes (REs) accumulate within the cell; accumulations can be of different size, abundance, and sub-cellular localisation; Autofluorescent lysosome-related organelles (AF/LROs) are enlarged or accumulated | |||
WBPhenotype:0002094 | Remark | PEPT-1::DsRED accumulated in fuzzy or irregularly shaped structures; PEPT-1::DsRED fluorescence intensity reduced; PEPT-1::DsRed can be retained in misplaced RAB-11-recycling endosomes (REs); GFP::RAB-11 recycling endosomes (REs) localise basally; GFP::RAB-11 recycling endosomes (REs) distribute evenly or scatter throughout the cell; GFP::RAB-11 recycling endosomes (REs) accumulate within the cell; accumulations can be of different size, abundance, and sub-cellular localisation; Autofluorescent lysosome-related organelles (AF/LROs) are enlarged or accumulated | |||
WBPhenotype:0002095 | Remark | PEPT-1::DsRED accumulated in fuzzy or irregularly shaped structures; PEPT-1::DsRED fluorescence intensity reduced; PEPT-1::DsRed can be retained in misplaced RAB-11-recycling endosomes (REs); GFP::RAB-11 recycling endosomes (REs) localise basally; GFP::RAB-11 recycling endosomes (REs) distribute evenly or scatter throughout the cell; GFP::RAB-11 recycling endosomes (REs) accumulate within the cell; accumulations can be of different size, abundance, and sub-cellular localisation; Autofluorescent lysosome-related organelles (AF/LROs) are enlarged or accumulated | |||
WBPhenotype:0002107 | Remark | PEPT-1::DsRED accumulated in fuzzy or irregularly shaped structures; PEPT-1::DsRED fluorescence intensity reduced; PEPT-1::DsRed can be retained in misplaced RAB-11-recycling endosomes (REs); GFP::RAB-11 recycling endosomes (REs) localise basally; GFP::RAB-11 recycling endosomes (REs) distribute evenly or scatter throughout the cell; GFP::RAB-11 recycling endosomes (REs) accumulate within the cell; accumulations can be of different size, abundance, and sub-cellular localisation; Autofluorescent lysosome-related organelles (AF/LROs) are enlarged or accumulated | |||
Remark | (Table S1, S3) R11A5.2/nud-2 RNAi | ||||
Method | RNAi |