WormBase Tree Display for RNAi: WBRNAi00090865
expand all nodes | collapse all nodes | view schema
| WBRNAi00090865 | Homol | Homol_homol | F07F6:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | ctccatttgctttctttgagcatcaatatcttgcatggcaaatttggcactgagcttttgcaatgcagcggcatcatcggattttttcttaccatcaagctctgtttgataagcaagcttgttcgcagcaacttcggcggccgtctgtctctctttttcagcagctctttgctcaatttcatcaaaattaatccgcactttttgagctccgagagcatttttcttggcgccgagagtggctttcttgattggttttttaagaatcacggaaactggagcagaggtaggaacagcgacggaagagtcgagatgatcaacgcttggaccgtgagtagagtcttcagatttgtgatcagcaatatatgcatcagaagacaaggaagtagcagatgcagaagtgtgaccgaaatcttgagcgaagaaatcttcttcct | |||
| Experiment | Laboratory | MZE | |||
| Date | 19 Apr 2012 00:00:00 | ||||
| Genotype | unc-119(ed3) III; cbgIs91[pPept-1:pept-1::DsRed;unc-119(+)]; cbgIs98[pPept-1:GFP::rab-11.1;unc-119(+)] | ||||
| Treatment | Animals were fed dsRNA-expressing bacteria from the L1 stage of the P0 generation; F1 young adult animals were imaged and scored for phenotypes | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | F07F6.4 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00017217 | Inferred_automatically | RNAi_primary | ||
| Transcript | F07F6.4.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00041129 | ||||
| Phenotype | WBPhenotype:0000679 | Remark | PEPT-1::DsRED accumulated in punctate structures | ||
| Remark | (Table S1, Figure 1d,e) F07F6.4 RNAi | ||||
| Method | RNAi |
