WormBase Tree Display for RNAi: WBRNAi00091209
expand all nodes | collapse all nodes | view schema
WBRNAi00091209 | Homol | Homol_homol | F07F6:RNAi | ||
---|---|---|---|---|---|
Sequence_info | DNA_text | ctccatttgctttctttgagcatcaatatcttgcatggcaaatttggcactgagcttttgcaatgcagcggcatcatcggattttttcttaccatcaagctctgtttgataagcaagcttgttcgcagcaacttcggcggccgtctgtctctctttttcagcagctctttgctcaatttcatcaaaattaatccgcactttttgagctccgagagcatttttcttggcgccgagagtggctttcttgattggttttttaagaatcacggaaactggagcagaggtaggaacagcgacggaagagtcgagatgatcaacgcttggaccgtgagtagagtcttcagatttgtgatcagcaatatatgcatcagaagacaaggaagtagcagatgcagaagtgtgaccgaaatcttgagcgaagaaatcttcttcct | |||
Experiment | Laboratory | MZE | |||
Date | 19 Apr 2012 00:00:00 | ||||
Genotype | unc-119(ed3) III; cbgIs91[pPept-1:pept-1::DsRed;unc-119(+)]; cbgIs100[pPept-1:aman-2::GFP;unc-119(+)] | ||||
Delivered_by | Bacterial_feeding | ||||
Inhibits | Predicted_gene | F07F6.4 | Inferred_automatically | RNAi_primary | |
Gene | WBGene00017217 | Inferred_automatically | RNAi_primary | ||
Transcript | F07F6.4.1 | Inferred_automatically | RNAi_primary | ||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00041129 | ||||
Phenotype | WBPhenotype:0000258 | Remark | PEPT-1::DsRED is accumulated in round, filled structures ('dots') that are positive for the Golgi marker AMAN-2::GFP | ||
WBPhenotype:0000679 | Remark | PEPT-1::DsRED is accumulated in round, filled structures ('dots') that are positive for the Golgi marker AMAN-2::GFP | |||
Remark | (Table S3) F07F6.4 RNAi | ||||
Method | RNAi |