WormBase Tree Display for RNAi: WBRNAi00093338
expand all nodes | collapse all nodes | view schema
| WBRNAi00093338 | Homol | Homol_homol | F46F11:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | ATGATTGAAATCACAGTAAACGATCGACTCGGAAAAAAAGTACGAATCAAGTGCAATCCATCAGATACAATTGGAGATTTGAAGAAGTTGATCGCTGCACAAACTGGAACACGATGGGAAAAGATCGTGTTGAAAAAGTGGTACACCATTTACAAGGATCATATCACATTGATGGATTACGAGATTCACGAGGGATTCAATTTCGAGCTCTACTACCAATGA | |||
| Experiment | Laboratory | AGD | |||
| Date | 30 Nov 2010 00:00:00 | ||||
| Genotype | sid-1(qt9); Pgly-19::ubl-5(hairpin) | ||||
| Delivered_by | Transgene_expression | ||||
| Inhibits | Predicted_gene | F46F11.4 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00006726 | Inferred_automatically | RNAi_primary | ||
| Transcript | F46F11.4.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00037991 | ||||
| Phenotype_not_observed | WBPhenotype:0000039 | Remark | Intestinal RNAi knockdown of ubl-5 does not affect life span | ||
| Remark | (Figure 6E) ulb-5 (hairpin) intestinal RNAi. Exact sequence used for RNAi not stated by authors, spliced coding region sequence of gene used for curation. | ||||
| Method | RNAi |
