WormBase Tree Display for RNAi: WBRNAi00098312
expand all nodes | collapse all nodes | view schema
WBRNAi00098312 | Homol | Homol_homol | B0025:RNAi | ||
---|---|---|---|---|---|
Sequence_info | DNA_text | TAAAGGAGTCCATCTTCCACTTGATCCAAGTTTCCGTTTATCATCAGTTATTCCTGATACAGCATCATTTTTCAAAAGTGAGATGATGCCTGCGAAGATATCATTCAAAGTTCTTCAGCCGAATGGAAAAGCTGATAGAAATATTCCAGAAGAATATACAGTTATATTTAAGACTGGAGATGATTTACGGCAAGATCAGCTGATTCAGCAAATGGTTCGACTTATTGATATTATTCTCAAAAAGGGACAATTGGATTTGAAGTTGACACCTTATTTGGTTCTCTCCACAGGTGTCGGTCAAGGATTTGTCCAATGCATAAAATCAAAACCATTGAGAGCAATTCAAGAACAATACAAAGCACATAAAATGGATTGTATTCGTGAAGCAATGAAAGAACTTCGTCCAGGAGATGGACCATTTGGTATTGAACCAAATGTAATCGATAATTATGTCCGTTCACTTGCTGGTTATTCAGTTATTATGTATATTCTGGGTCTTGGTGATCGTCATCTTGACAA | |||
Experiment | Laboratory | ZH | |||
Date | 05 Dec 2011 00:00:00 | ||||
Genotype | Pced-1::2xFYVE::GFP (marker for phosphatidylinositol 3-phosphate (PtdIns(3)P) in apoptotic corpse-engulfing cells) | ||||
Treatment | Mid-L4-stage hermaphrodites were transferred to RNAi plates. Animals were analyzed 48 hours after the mid-L4 stage for germ cell corpses and 2xFYVE::GFP-positive phagosomes. | ||||
Delivered_by | Bacterial_feeding | ||||
Inhibits | Predicted_gene | B0025.1c | Inferred_automatically | RNAi_primary | |
B0025.1a | Inferred_automatically | RNAi_primary | |||
Gene | WBGene00006932 | Inferred_automatically | RNAi_primary | ||
Transcript | B0025.1c.1 | Inferred_automatically | RNAi_primary | ||
B0025.1a.1 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00040691 | ||||
Phenotype | WBPhenotype:0000243 | Remark | vps-34(C) RNAi (targeting C-terminal VPS-34) results in a modest accumulation of germ cell corpses, a mild cell-corpse removal defective phenotype, and a reduced percentage of gonadal phagosomes labeled with 2xFYVE::GFP, a marker for phosphatidylinositol 3-phosphate (PtdIns(3)P). | ||
WBPhenotype:0000679 | Remark | vps-34(C) RNAi (targeting C-terminal VPS-34) results in a modest accumulation of germ cell corpses, a mild cell-corpse removal defective phenotype, and a reduced percentage of gonadal phagosomes labeled with 2xFYVE::GFP, a marker for phosphatidylinositol 3-phosphate (PtdIns(3)P). | |||
WBPhenotype:0001180 | Remark | vps-34(C) RNAi (targeting C-terminal VPS-34) results in a modest accumulation of germ cell corpses, a mild cell-corpse removal defective phenotype, and a reduced percentage of gonadal phagosomes labeled with 2xFYVE::GFP, a marker for phosphatidylinositol 3-phosphate (PtdIns(3)P). | |||
WBPhenotype:0001846 | Remark | vps-34(C) RNAi (targeting C-terminal VPS-34) results in a modest accumulation of germ cell corpses, a mild cell-corpse removal defective phenotype, and a reduced percentage of gonadal phagosomes labeled with 2xFYVE::GFP, a marker for phosphatidylinositol 3-phosphate (PtdIns(3)P). | |||
Remark | (Figure 1A,C, 8E, S1) vps-34(C) RNAi | ||||
Method | RNAi |