WormBase Tree Display for RNAi: WBRNAi00098314

WBRNAi00098314 Homol: Homol_homol: B0025:RNAi
  Sequence_info: DNA_text: TAAAGGAGTCCATCTTCCACTTGATCCAAGTTTCCGTTTATCATCAGTTATTCCTGATACAGCATCATTTTTCAAAAGTGAGATGATGCCTGCGAAGATATCATTCAAAGTTCTTCAGCCGAATGGAAAAGCTGATAGAAATATTCCAGAAGAATATACAGTTATATTTAAGACTGGAGATGATTTACGGCAAGATCAGCTGATTCAGCAAATGGTTCGACTTATTGATATTATTCTCAAAAAGGGACAATTGGATTTGAAGTTGACACCTTATTTGGTTCTCTCCACAGGTGTCGGTCAAGGATTTGTCCAATGCATAAAATCAAAACCATTGAGAGCAATTCAAGAACAATACAAAGCACATAAAATGGATTGTATTCGTGAAGCAATGAAAGAACTTCGTCCAGGAGATGGACCATTTGGTATTGAACCAAATGTAATCGATAATTATGTCCGTTCACTTGCTGGTTATTCAGTTATTATGTATATTCTGGGTCTTGGTGATCGTCATCTTGACAA
  Experiment: Laboratory: ZH
    Date: 05 Dec 2011 00:00:00
    Genotype: piki-1(tm3171); Pced-1::2xFYVE::GFP (marker for phosphatidylinositol 3-phosphate (PtdIns(3)P) in apoptotic corpse-engulfing cells)
    Treatment: Mid-L4-stage hermaphrodites were transferred to RNAi plates. Animals were analyzed 48 hours after the mid-L4 stage for germ cell corpses and 2xFYVE::GFP-positive phagosomes.
    Delivered_by: Bacterial_feeding
  Inhibits: Predicted_gene: B0025.1c Inferred_automatically: RNAi_primary
      B0025.1a Inferred_automatically: RNAi_primary
    Gene: WBGene00006932 Inferred_automatically: RNAi_primary
    Transcript: B0025.1c.1 Inferred_automatically: RNAi_primary
      B0025.1a.1 Inferred_automatically: RNAi_primary
  Species: Caenorhabditis elegans
  Reference: WBPaper00040691
  Phenotype: WBPhenotype:0000243 Remark: vps-34(C) RNAi (targeting C-terminal VPS-34) enhanced the increased accumulation of germ cell corpses, the cell-corpse removal defective phenotype, and the reduced percentage of gonadal phagosomes labeled with 2xFYVE::GFP (a marker for phosphatidylinositol 3-phosphate (PtdIns(3)P)) caused by the piki-1(tm3171) mutation.
    WBPhenotype:0000679 Remark: vps-34(C) RNAi (targeting C-terminal VPS-34) enhanced the increased accumulation of germ cell corpses, the cell-corpse removal defective phenotype, and the reduced percentage of gonadal phagosomes labeled with 2xFYVE::GFP (a marker for phosphatidylinositol 3-phosphate (PtdIns(3)P)) caused by the piki-1(tm3171) mutation.
    WBPhenotype:0001180 Remark: vps-34(C) RNAi (targeting C-terminal VPS-34) enhanced the increased accumulation of germ cell corpses, the cell-corpse removal defective phenotype, and the reduced percentage of gonadal phagosomes labeled with 2xFYVE::GFP (a marker for phosphatidylinositol 3-phosphate (PtdIns(3)P)) caused by the piki-1(tm3171) mutation.
    WBPhenotype:0001846 Remark: vps-34(C) RNAi (targeting C-terminal VPS-34) enhanced the increased accumulation of germ cell corpses, the cell-corpse removal defective phenotype, and the reduced percentage of gonadal phagosomes labeled with 2xFYVE::GFP (a marker for phosphatidylinositol 3-phosphate (PtdIns(3)P)) caused by the piki-1(tm3171) mutation.
  Remark: (Figure 1A,C) vps-34(C) RNAi
  Method: RNAi