WormBase Tree Display for RNAi: WBRNAi00101326

WBRNAi00101326 Homol: Homol_homol: T23D8:RNAi
  Sequence_info: DNA_text: ATGCATCGACATATTCTGATATTATTTTTATTCGGATGCTTATCAGCTGATCAACGACTCTCATCAACTTCAATTTCATCGATGAATGGATTCTCAACAACTCGAAAATGTGAACATATTACAATTCCAATGTGCAAAAATCTGGATTACAATCAAACAGTATTTCCAAATCTTCTCGGACATACAACACAATCTGAAGCTGGTCCAGCAATTGCGCAATTCAATCCATTAATTAAAGTTAAATGCTCAGAAGATATTCGTCTCTTTCTTTGTACTGTCTATGCACCTGTCTGTACAGTACTCGAAAAACCAATTCAACCATGTCGAGAATTGTGTTTATCTGCAAAAAATGGATGCGAGTCATTAATGAAAAAGTTTGGATTTCAATGGCCAGATCAATTGGATTGTAACAAATTCCCAGTAACTGATTTGTGTGTTGGCAAGAATTCCAGCGAGTCGAGCAACTCTAAAA
  Experiment: Laboratory: SK
    Date: 17 Nov 2013 00:00:00
    Genotype: mig-1(e1787) lin-17(n677); cfz-2(ok1201); mec-4::mom-5(RNAi); PLR-1-mCherry
    Delivered_by: Transgene_expression
  Inhibits: Predicted_gene: T23D8.1b Inferred_automatically: RNAi_primary
      T23D8.1a Inferred_automatically: RNAi_primary
    Gene: WBGene00003397 Inferred_automatically: RNAi_primary
    Transcript: T23D8.1b.1 Inferred_automatically: RNAi_primary
      T23D8.1a.1 Inferred_automatically: RNAi_primary
  Species: Caenorhabditis elegans
  Reference: WBPaper00044679
  Phenotype: WBPhenotype:0000679 Remark: PLR-1 accumulates at the surface in this background. Normally PLR-1 is enriched in endosomes and not detected at the cell surface, that is in wild-type, mec-4::mom-5(RNAi) and mig-1 lin-17; cfz-2 triple mutant animals, PLR-1 exhibits a punctate localization pattern (not detected at the surface). It is only in mig-1(e1787) lin-17(n677); cfz-2(ok1201); mec-4::mom-5(RNAi) that surface accumulation is observed. Thus, elimination or reduction of endogenously expressed Frizzleds causes cell-surface accumulation of PLR-1.
  Remark: mec-4 promoter was used for specific RNAi of mom-5 in mec-4 expressing cells to circumvent lethality caused by mom-5 RNAi in the entire animal. Exact sequence used for RNAi not stated by authors, exon 1 used for curation.
  Method: RNAi