WormBase Tree Display for RNAi: WBRNAi00101454

WBRNAi00101454 Homol: Homol_homol: C03C10:RNAi
  Sequence_info: DNA_text: ATGGCAGGTGTGATGTCAGTTAAGGACTTCATCGTTGCGACAAAATACAAGCTCATACGAAAAATCGGATCAGGATCATTCGGTGACATTTATGTATCGATCAACGTGACGAACGGCGAGGAGGTGGCCATTAAGCTGGAAAGCAATCGGGCGAGGCACCCGCAGTTGCTGTACGAGTCCAAAGTGTATCGTATCCTACAGGGAGGAGTCGGAATTCCACATATCAGATGGTACGGAACCGAGCGAGAGTACAATGTGCTTGTCATGGATCTTCTCGGTCCTTCATTGGAAGATCTCTTCAATTTCTGCTCCAGAAGATTTACCATGAAGACTGTTCTCATGCTGGCTGACCAGATGATCGGACGTATCGAATATGTGCATGTCAAGAACTTTATTCATCGTGACATAAAGCCAGACAACTTCTTGATGGGAATAGGACGTCACTGCAACAAGCTCTTCTTGATCGACTTCGGATTGGCCAAAAAATACCGTGATTCACGCACCAGAACTCATATTCCATACAGAGAGGACAAGAACTTGACCGGTACCGCCAGATACGCATCCATCAACGCCCACTTGGGAATTGAGCAGTCGAGAAGAGATGACATGGAATCCCTTGGATACGTTTTGATGTACTTCAACCGTGGAACTCTTCCATGGCAAGGATTGAAGGCCGCCACGAAAAAGCAAAAGTATGAGAAGATTTCTGAGAAGAAAATGACGACATCAGTCGAGCACTTGTGCAAAGGATTCCCAGCTGAGTTCCCAATGTACTTGAGCTACACAAGAGGACTTCGTTTCGATGAATCTCCAGATTACATGTACTTGCGGCAACTGTTCAGAATTCTCTTCAGAACGCTCAATCATCAGTACGACTACACATTCGACTGGACAATGCTCAAACAAAAGGCTCAACAATCGCAATCCAGTGGCGTCCCCGGAACCAACACTACTACACAGGGAGCTACCGTTCCATCAGCTGGAGTTCCAGCTGGAGTTGCACCAGGAGGAACTACTCCACAGTAA
  Experiment: Laboratory: CT
    Date: 01 Nov 2010 00:00:00
    Treatment: RNAi was induced by feeding, starting with L1 stage starved and synchronized animals. RNAi constructs were expressed from E. coli HT115(DE3) bacteria, which were grown on NGM media containing 1 mM IPTG to induce expression from the convergent T7 polymerase promoters on the pL4440 vector. All strains feeding on RNAi bacteria were cultured at 20 degrees Celsius unless otherwise noted.
    Temperature: 20
    Delivered_by: Bacterial_feeding
  Inhibits: Predicted_gene: C03C10.1 Inferred_automatically: RNAi_primary
    Gene: WBGene00002202 Inferred_automatically: RNAi_primary
    Transcript: C03C10.1.3 Inferred_automatically: RNAi_primary
      C03C10.1.1 Inferred_automatically: RNAi_primary
      C03C10.1.2 Inferred_automatically: RNAi_primary
  Species: Caenorhabditis elegans
  Reference: WBPaper00037838
  Phenotype: WBPhenotype:0000022 Remark: At the gross anatomical level, kin-19(RNAi) resulted in adult animals that were thin and elongated in shape, had protruding vulva (Pvl), and were sterile.
      EQ_annotations: Life_stage: WBls:0000041 PATO:0000460
    WBPhenotype:0000164 Remark: At the gross anatomical level, kin-19(RNAi) resulted in adult animals that were thin and elongated in shape, had protruding vulva (Pvl), and were sterile.
      EQ_annotations: Life_stage: WBls:0000041 PATO:0000460
    WBPhenotype:0000688 Remark: At the gross anatomical level, kin-19(RNAi) resulted in adult animals that were thin and elongated in shape, had protruding vulva (Pvl), and were sterile.
      EQ_annotations: Life_stage: WBls:0000041 PATO:0000460
    WBPhenotype:0000697 Remark: At the gross anatomical level, kin-19(RNAi) resulted in adult animals that were thin and elongated in shape, had protruding vulva (Pvl), and were sterile.
      EQ_annotations: Life_stage: WBls:0000041 PATO:0000460
  Remark: (Data not shown) kin-19 RNAi. Exact sequence used for RNAi not stated by authors, spliced coding region sequence of gene used for curation.
  Method: RNAi