WormBase Tree Display for RNAi: WBRNAi00102457
expand all nodes | collapse all nodes | view schema
| WBRNAi00102457 | Homol | Homol_homol | Y37E3:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | gatatccggtcaacgccgagagccgtcaccaccatcactggaagtaaagacttgcaaaacgtcaacattactctccgtatccttcacagaccaagccccgatcgtcttccaaacatctacctgaacattggtttggactacgcagaaagagtccttccttccattacaaatgaagttttgaaggctgttgtggtgagaaaaaattttaatttaaatattgcgaactgattttgatttaaaatttgttaaaattaattccaggcgcaattcgatgctcatgagatgatcacccagcgtgaggttgtctcccaacgggcgtccgtggctcttcgtgaacgtgctgcacagttcggacttctccttgatgatattgcaattgtaagttcaccagatttatgaagtttaagctatttccatgatttttcagacccacttgaactttggacgtgaattcactgaagccgtcgaaatgaagcaagtcgcacagcaagaagccgaaaaagcgagataccttgtcgagaaggctgaacaaatgaagatcgccgccgttaccaccgccgaaggagatgctcaagccgcaaagcttcttgccaaggcctttgcctctgccggagacggacttgtcgagctc | |||
| Experiment | Laboratory | IR | |||
| Date | 24 Aug 2009 00:00:00 | ||||
| Strain | WBStrain00004851 | ||||
| Temperature | 20 | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | Y37E3.9 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00004014 | Inferred_automatically | RNAi_primary | ||
| Transcript | Y37E3.9.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00035277 | ||||
| Phenotype_not_observed | WBPhenotype:0000679 | Remark | phb-1 RNAi does not affect the subcellular localization of constitutively nuclear-localized DAF-16::GFP in a daf-16(mu86) mutant background | ||
| Remark | (Figure S8b) phb-1 RNAi | ||||
| Method | RNAi |
