WormBase Tree Display for RNAi: WBRNAi00103853
expand all nodes | collapse all nodes | view schema
WBRNAi00103853 | Homol | Homol_homol | Y38A8:RNAi | |||
---|---|---|---|---|---|---|
Sequence_info | DNA_text | ATGAGTGATTCAACTCAAATGGAGGCCAATGCTGCTATTAATGAAATTAAAAAACGAACGAGAAAGCTAGACCAATCGCTGCAAATGAGGTTTTGCGCTGATCAGTTTTTCATCGGCAATCATTGCACCAAACTGGCATCCGGAAAGTCAATAATTATCTCGCAGAATTCCAAGAATCGGATATGCCTTCGCTTTTTCATGGCAGCGGATCCTTTGGTGGGCTACACTGGACGAGATTTTGGAATCGCTTTCAATCAGATAGACCACATTTCGCTGAAAGATGAGCAACAAGAGAATCCCGCTGTACTCATTTGCACTTTGAACCTCTCAAGCTACACAAAAATGTGTAAGCTCCAAACCGGCTTGAAGGATGTCGTCGAGAAACCATTTCTGTATAACAAATCTCTTGCACGGAATTTGACATTCATACTTAAACCGTGGAACGATGACCCTGACACGTTTGTGAAGATCTCATACAATGATGAACACCGAGAGTATGTGCACAGCTATGATTACGATGTGGCCAAGTCCTTAATGTTCAAAGAG | ||||
GATTTTCCAAACTTTGACTGGTCAAAGTTCTTCCCGGAGGCCAATAAAATGTGTGACTTGATGCGAGACAAAGTTTACAATTTGATTCTTCAACAAGCGGATAAACCTGCGAGAAGCCGTCTCGCCAAGTTCGAAAGGGAGAACAAATGTGGATTGTCGCGTGAAGGAGCTCTTAGGAAAGCACGTCGTCATAGTGCAGTGAATGAACGTCGTACGAAACGGCACAGAGACTATTATGCACGTCACTATTCCTTGAGCCCGCCACACCGAAATGTGATGAACGATGATCCGACGTTCATGAATCCACGTGGATTGGCGGAAATGCCAATAACTCGACTTGTTCGTCGCCTCAGAATTCCGGAGGATAACTTCCCAATCGCTTACTAG | ||||||
Experiment | Genotype | HMR-1::GFP; VAB-10ABD::mCherry | ||||
Treatment | Injected worms were allowed to recover on NGM plates overnight at 20 degrees Celsius and then transferred to fresh plates. F1 gravid adults were cut and the released F2 embryos were analyzed. | |||||
Temperature | 20 | |||||
Delivered_by | Injection | |||||
Inhibits | Predicted_gene | Y38A8.3c | Inferred_automatically | RNAi_primary | ||
Y38A8.3a | Inferred_automatically | RNAi_primary | ||||
Y38A8.3b | Inferred_automatically | RNAi_primary | ||||
Gene | WBGene00006737 | Inferred_automatically | RNAi_primary | |||
Transcript | Y38A8.3c.1 | Inferred_automatically | RNAi_primary | |||
Y38A8.3b.1 | Inferred_automatically | RNAi_primary | ||||
Y38A8.3a.1 | Inferred_automatically | RNAi_primary | ||||
Species | Caenorhabditis elegans | |||||
Reference | WBPaper00048594 | |||||
Phenotype | WBPhenotype:0000679 | Remark | Embryos subjected to ulp-2 RNAi exhibited discontinuous HMR-1::GFP foci and collapsed actin bundles (Figures 7C-7E). In WT embryos, actin bundles are arranged in parallel bands, and HMR-1::GFP is localized at the base of the actin bundle anchoring it to the membrane at AJs. In ulp-2(RNAi) embryos, loss of HMR-1 at the apical junction is accompanied by collapse and random spacing of actin bundles. | |||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | |||
GO_term | GO:0051017 | PATO:0000460 | ||||
WBPhenotype:0002124 | Remark | Embryos subjected to ulp-2 RNAi exhibited discontinuous HMR-1::GFP foci and collapsed actin bundles (Figures 7C-7E). In WT embryos, actin bundles are arranged in parallel bands, and HMR-1::GFP is localized at the base of the actin bundle anchoring it to the membrane at AJs. In ulp-2(RNAi) embryos, loss of HMR-1 at the apical junction is accompanied by collapse and random spacing of actin bundles. | ||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | |||
GO_term | GO:0051017 | PATO:0000460 | ||||
Remark | (Figure 7C-E) ulp-2 RNAi against exons 1-4 and 15 | |||||
Method | RNAi |